Incidental Mutation 'R6478:Abcc9'
ID516907
Institutional Source Beutler Lab
Gene Symbol Abcc9
Ensembl Gene ENSMUSG00000030249
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 9
SynonymsSUR2B, Sur2, SUR2A
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001044720.1; MGI: 1352630

Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R6478 (G1)
Quality Score223.009
Status Validated
Chromosome6
Chromosomal Location142587862-142702315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 142679308 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 454 (A454T)
Ref Sequence ENSEMBL: ENSMUSP00000144779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073173] [ENSMUST00000087527] [ENSMUST00000100827] [ENSMUST00000111771] [ENSMUST00000205202]
Predicted Effect probably damaging
Transcript: ENSMUST00000073173
AA Change: A454T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072914
Gene: ENSMUSG00000030249
AA Change: A454T

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 7.7e-33 PFAM
AAA 659 867 3.11e-13 SMART
coiled coil region 881 935 N/A INTRINSIC
Pfam:ABC_membrane 956 1228 6.6e-35 PFAM
AAA 1300 1502 9.94e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087527
AA Change: A454T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084805
Gene: ENSMUSG00000030249
AA Change: A454T

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 8e-33 PFAM
AAA 694 902 3.11e-13 SMART
coiled coil region 916 970 N/A INTRINSIC
Pfam:ABC_membrane 991 1263 6.8e-35 PFAM
AAA 1335 1537 9.94e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100827
AA Change: A454T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098390
Gene: ENSMUSG00000030249
AA Change: A454T

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 7.1e-35 PFAM
AAA 694 902 3.11e-13 SMART
coiled coil region 916 970 N/A INTRINSIC
Pfam:ABC_membrane 991 1263 5.2e-38 PFAM
AAA 1335 1520 5.13e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111771
AA Change: A454T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107401
Gene: ENSMUSG00000030249
AA Change: A454T

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 1.4e-32 PFAM
AAA 694 889 3.77e-12 SMART
coiled coil region 903 957 N/A INTRINSIC
Pfam:ABC_membrane 978 1250 1.2e-34 PFAM
AAA 1322 1524 9.94e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205202
AA Change: A454T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144779
Gene: ENSMUSG00000030249
AA Change: A454T

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 6.9e-35 PFAM
AAA 659 867 3.11e-13 SMART
coiled coil region 881 935 N/A INTRINSIC
Pfam:ABC_membrane 956 1228 5e-38 PFAM
AAA 1300 1502 9.94e-12 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 95% (75/79)
MGI Phenotype Strain: 2155916
Lethality: D42-D210
FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein is thought to form ATP-sensitive potassium channels in cardiac, skeletal, and vascular and non-vascular smooth muscle. Protein structure suggests a role as the drug-binding channel-modulating subunit of the extrapancreatic ATP-sensitive potassium channels. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele display lower serum glucose, enhanced insulin action, growth retardation, hypertension and spontaneous death due to episodic coronary artery vasospasm. Homozygous exon 5 deletion leads to cardiac mitochondrial defects, cardiomyopathy, and early postnatal death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,332 V306A possibly damaging Het
9530053A07Rik C G 7: 28,155,373 P1808R probably damaging Het
Aatk T A 11: 120,010,991 S803C probably benign Het
Abr T C 11: 76,452,332 E565G probably damaging Het
Adam33 C A 2: 131,051,346 R753L probably benign Het
Adgre1 A G 17: 57,401,955 T49A possibly damaging Het
AI314180 A T 4: 58,810,785 I1524N probably damaging Het
Ankra2 A T 13: 98,268,442 H153L probably damaging Het
Ankrd26 T G 6: 118,511,638 E1353D probably benign Het
Ankrd52 T G 10: 128,379,331 probably null Het
Arhgef10l T A 4: 140,542,757 T619S possibly damaging Het
Asgr1 T C 11: 70,056,894 V130A possibly damaging Het
Atg10 C A 13: 90,937,347 C161F probably damaging Het
Atm A T 9: 53,490,254 N1438K probably damaging Het
BC107364 T A 3: 96,436,006 probably null Het
Bcar3 G T 3: 122,426,576 A41S probably benign Het
Btbd6 A G 12: 112,977,312 probably benign Het
Cchcr1 A G 17: 35,524,703 T318A possibly damaging Het
Celsr1 A T 15: 85,925,518 I2221N probably damaging Het
Cept1 C T 3: 106,533,445 W48* probably null Het
Cfap161 T A 7: 83,793,276 I85L probably benign Het
Clasp1 A T 1: 118,512,180 R640* probably null Het
Col5a1 T A 2: 27,952,436 I441N unknown Het
Col9a1 C A 1: 24,185,405 L223I unknown Het
Dnah2 T C 11: 69,516,010 D223G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpy19l1 A T 9: 24,450,696 M129K possibly damaging Het
Fcrl1 C A 3: 87,389,639 H318Q probably benign Het
Fer1l5 A G 1: 36,402,531 N609S probably damaging Het
Fkbp4 C T 6: 128,433,231 E256K probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Glrx G A 13: 75,847,299 probably null Het
Gm6614 A T 6: 141,993,642 N208K possibly damaging Het
Gm7356 A T 17: 14,001,464 M101K probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Hectd3 A C 4: 116,999,586 K443N probably damaging Het
Hmcn1 T A 1: 150,664,784 R2925W probably damaging Het
Hspa1a G T 17: 34,970,306 N540K probably damaging Het
Ints6 A T 14: 62,700,786 M649K probably benign Het
Katnb1 T C 8: 95,095,456 V270A possibly damaging Het
Kctd3 A G 1: 188,972,364 S737P probably benign Het
Klra10 T C 6: 130,272,544 probably null Het
Lmtk3 A G 7: 45,798,589 D1353G unknown Het
Lrrk1 A G 7: 66,262,733 V1693A probably damaging Het
Mpnd A T 17: 56,009,575 I85F probably damaging Het
Myo3b A G 2: 70,348,960 T1173A probably benign Het
Myof G A 19: 37,903,831 P1158L probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ncor2 A G 5: 125,110,005 probably benign Het
Npepps C T 11: 97,258,273 probably null Het
Olfr1247 T G 2: 89,609,446 I219L probably damaging Het
Opn5 T A 17: 42,580,749 I266F probably benign Het
P2rx4 A G 5: 122,707,700 D16G probably damaging Het
Padi2 G T 4: 140,917,637 V61L probably benign Het
Pkd1l1 G A 11: 8,863,911 T1480I probably benign Het
Plcb1 T C 2: 135,335,451 S568P probably damaging Het
Rassf10 A G 7: 112,955,707 E505G probably damaging Het
Rcan2 A G 17: 43,836,334 E21G probably benign Het
Rhob G T 12: 8,499,585 C16* probably null Het
Ryr3 T C 2: 112,660,068 N3807S probably damaging Het
Sass6 T A 3: 116,621,397 N519K probably benign Het
Smad9 A T 3: 54,782,443 D28V probably damaging Het
Tepp A T 8: 95,321,266 probably null Het
Tex14 G T 11: 87,514,373 G704C probably benign Het
Tmc3 A G 7: 83,622,316 N892S probably benign Het
Tnfaip2 T A 12: 111,445,663 L166Q probably damaging Het
Triml2 A G 8: 43,185,128 probably null Het
Trio A G 15: 27,856,107 V666A probably benign Het
Tshz2 G T 2: 169,884,664 L393F probably damaging Het
Ttn T G 2: 76,841,771 probably benign Het
Tubb5 A G 17: 35,835,842 Y159H probably damaging Het
Umodl1 A G 17: 30,959,155 Y35C probably damaging Het
Utp4 T C 8: 106,904,446 probably null Het
Vmn1r60 A T 7: 5,544,865 C79S probably damaging Het
Wnt5b T C 6: 119,433,790 T230A probably damaging Het
Zfp618 A T 4: 63,132,706 I575F probably damaging Het
Zmym6 G T 4: 127,123,383 V894L possibly damaging Het
Zpbp T C 11: 11,462,318 probably benign Het
Other mutations in Abcc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcc9 APN 6 142633190 splice site probably benign
IGL00670:Abcc9 APN 6 142687281 missense probably damaging 1.00
IGL00675:Abcc9 APN 6 142664621 missense probably damaging 1.00
IGL00741:Abcc9 APN 6 142687230 missense probably benign
IGL01371:Abcc9 APN 6 142656614 missense probably benign 0.04
IGL01686:Abcc9 APN 6 142603075 missense possibly damaging 0.71
IGL01724:Abcc9 APN 6 142664533 missense probably benign 0.00
IGL01807:Abcc9 APN 6 142605914 missense probably damaging 1.00
IGL01941:Abcc9 APN 6 142605904 missense probably damaging 1.00
IGL01946:Abcc9 APN 6 142626037 missense probably benign 0.16
IGL02210:Abcc9 APN 6 142687371 missense probably damaging 1.00
IGL02498:Abcc9 APN 6 142671539 critical splice donor site probably null
IGL02535:Abcc9 APN 6 142628426 missense probably benign 0.00
IGL02552:Abcc9 APN 6 142605919 missense possibly damaging 0.94
IGL02812:Abcc9 APN 6 142697790 missense possibly damaging 0.77
IGL02954:Abcc9 APN 6 142646281 missense probably damaging 0.97
IGL03035:Abcc9 APN 6 142627593 missense probably damaging 1.00
IGL03040:Abcc9 APN 6 142652597 nonsense probably null
IGL03100:Abcc9 APN 6 142694544 missense probably damaging 1.00
IGL03157:Abcc9 APN 6 142605923 splice site probably benign
R0054:Abcc9 UTSW 6 142601774 critical splice donor site probably null
R0054:Abcc9 UTSW 6 142601774 critical splice donor site probably null
R0084:Abcc9 UTSW 6 142658551 missense probably damaging 0.97
R0211:Abcc9 UTSW 6 142688984 missense probably benign 0.01
R0349:Abcc9 UTSW 6 142664625 missense probably benign 0.00
R0387:Abcc9 UTSW 6 142639504 nonsense probably null
R0393:Abcc9 UTSW 6 142645878 splice site probably benign
R0528:Abcc9 UTSW 6 142692880 missense probably damaging 1.00
R0588:Abcc9 UTSW 6 142603061 nonsense probably null
R0646:Abcc9 UTSW 6 142682104 missense probably benign 0.05
R0691:Abcc9 UTSW 6 142639253 missense possibly damaging 0.94
R0881:Abcc9 UTSW 6 142646303 missense probably damaging 1.00
R1264:Abcc9 UTSW 6 142646377 splice site probably benign
R1340:Abcc9 UTSW 6 142682855 splice site probably benign
R1413:Abcc9 UTSW 6 142590496 missense probably damaging 1.00
R1413:Abcc9 UTSW 6 142627519 missense possibly damaging 0.65
R1535:Abcc9 UTSW 6 142664635 missense probably damaging 1.00
R1595:Abcc9 UTSW 6 142633095 missense probably benign 0.02
R1670:Abcc9 UTSW 6 142594722 missense possibly damaging 0.89
R1769:Abcc9 UTSW 6 142627468 splice site probably benign
R1888:Abcc9 UTSW 6 142679314 missense probably benign
R1888:Abcc9 UTSW 6 142679314 missense probably benign
R1918:Abcc9 UTSW 6 142697682 missense probably damaging 1.00
R1925:Abcc9 UTSW 6 142671607 missense probably damaging 0.98
R2019:Abcc9 UTSW 6 142675434 missense probably damaging 1.00
R2698:Abcc9 UTSW 6 142633136 missense possibly damaging 0.93
R2860:Abcc9 UTSW 6 142626010 missense probably benign 0.01
R2861:Abcc9 UTSW 6 142626010 missense probably benign 0.01
R2980:Abcc9 UTSW 6 142687308 missense probably benign 0.00
R3115:Abcc9 UTSW 6 142689029 missense probably benign 0.08
R3617:Abcc9 UTSW 6 142679289 missense probably damaging 0.97
R3880:Abcc9 UTSW 6 142639233 missense probably damaging 1.00
R4063:Abcc9 UTSW 6 142605919 missense possibly damaging 0.94
R4065:Abcc9 UTSW 6 142645890 missense probably damaging 1.00
R4290:Abcc9 UTSW 6 142594012 missense probably benign 0.08
R4538:Abcc9 UTSW 6 142614412 critical splice donor site probably null
R4615:Abcc9 UTSW 6 142689107 missense possibly damaging 0.93
R4659:Abcc9 UTSW 6 142672595 splice site probably null
R4774:Abcc9 UTSW 6 142639317 missense probably damaging 1.00
R4788:Abcc9 UTSW 6 142620730 nonsense probably null
R4832:Abcc9 UTSW 6 142671556 missense probably damaging 1.00
R4844:Abcc9 UTSW 6 142689098 missense probably benign 0.09
R4903:Abcc9 UTSW 6 142600965 missense probably damaging 1.00
R4921:Abcc9 UTSW 6 142590436 missense probably benign
R4960:Abcc9 UTSW 6 142620783 splice site probably null
R4983:Abcc9 UTSW 6 142682141 missense probably benign 0.44
R4986:Abcc9 UTSW 6 142627591 missense probably benign 0.00
R5060:Abcc9 UTSW 6 142626110 intron probably benign
R5120:Abcc9 UTSW 6 142656618 missense probably benign 0.00
R5198:Abcc9 UTSW 6 142626000 missense probably benign 0.00
R5301:Abcc9 UTSW 6 142590481 missense probably benign 0.41
R5328:Abcc9 UTSW 6 142682059 missense probably benign 0.25
R5568:Abcc9 UTSW 6 142689016 missense possibly damaging 0.62
R5654:Abcc9 UTSW 6 142625645 intron probably benign
R5694:Abcc9 UTSW 6 142600947 missense probably damaging 1.00
R5734:Abcc9 UTSW 6 142625731 intron probably benign
R5774:Abcc9 UTSW 6 142628559 missense probably damaging 0.98
R5802:Abcc9 UTSW 6 142656676 critical splice acceptor site probably null
R5890:Abcc9 UTSW 6 142604828 critical splice donor site probably null
R5946:Abcc9 UTSW 6 142625952 missense probably damaging 1.00
R5971:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
R6078:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
R6392:Abcc9 UTSW 6 142682099 missense probably damaging 1.00
R6400:Abcc9 UTSW 6 142692709 makesense probably null
R6481:Abcc9 UTSW 6 142604895 missense probably damaging 0.99
R6564:Abcc9 UTSW 6 142603108 missense probably damaging 1.00
R6700:Abcc9 UTSW 6 142687287 missense possibly damaging 0.94
R6902:Abcc9 UTSW 6 142679227 missense probably damaging 1.00
R6946:Abcc9 UTSW 6 142679227 missense probably damaging 1.00
R6989:Abcc9 UTSW 6 142688981 missense probably damaging 0.97
R7052:Abcc9 UTSW 6 142658535 missense probably benign 0.00
R7062:Abcc9 UTSW 6 142599146 missense probably damaging 1.00
R7121:Abcc9 UTSW 6 142689127 nonsense probably null
U15987:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGGATTGGCCTCTTGTATT -3'
(R):5'- CCCCAGATAAACTTCCCATGATAT -3'

Sequencing Primer
(F):5'- TGGATTGGCCTCTTGTATTATAAAAG -3'
(R):5'- GACAGCATTTGTCCCCTT -3'
Posted On2018-05-21