Incidental Mutation 'R6478:9530053A07Rik'
ID516909
Institutional Source Beutler Lab
Gene Symbol 9530053A07Rik
Ensembl Gene ENSMUSG00000078776
Gene NameRIKEN cDNA 9530053A07 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6478 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location28129466-28164811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 28155373 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 1808 (P1808R)
Ref Sequence ENSEMBL: ENSMUSP00000114986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
Predicted Effect probably damaging
Transcript: ENSMUST00000059886
AA Change: P1808R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: P1808R

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150948
AA Change: P1808R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: P1808R

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 95% (75/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,332 V306A possibly damaging Het
Aatk T A 11: 120,010,991 S803C probably benign Het
Abcc9 C T 6: 142,679,308 A454T probably damaging Het
Abr T C 11: 76,452,332 E565G probably damaging Het
Adam33 C A 2: 131,051,346 R753L probably benign Het
Adgre1 A G 17: 57,401,955 T49A possibly damaging Het
AI314180 A T 4: 58,810,785 I1524N probably damaging Het
Ankra2 A T 13: 98,268,442 H153L probably damaging Het
Ankrd26 T G 6: 118,511,638 E1353D probably benign Het
Ankrd52 T G 10: 128,379,331 probably null Het
Arhgef10l T A 4: 140,542,757 T619S possibly damaging Het
Asgr1 T C 11: 70,056,894 V130A possibly damaging Het
Atg10 C A 13: 90,937,347 C161F probably damaging Het
Atm A T 9: 53,490,254 N1438K probably damaging Het
BC107364 T A 3: 96,436,006 probably null Het
Bcar3 G T 3: 122,426,576 A41S probably benign Het
Btbd6 A G 12: 112,977,312 probably benign Het
Cchcr1 A G 17: 35,524,703 T318A possibly damaging Het
Celsr1 A T 15: 85,925,518 I2221N probably damaging Het
Cept1 C T 3: 106,533,445 W48* probably null Het
Cfap161 T A 7: 83,793,276 I85L probably benign Het
Clasp1 A T 1: 118,512,180 R640* probably null Het
Col5a1 T A 2: 27,952,436 I441N unknown Het
Col9a1 C A 1: 24,185,405 L223I unknown Het
Dnah2 T C 11: 69,516,010 D223G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpy19l1 A T 9: 24,450,696 M129K possibly damaging Het
Fcrl1 C A 3: 87,389,639 H318Q probably benign Het
Fer1l5 A G 1: 36,402,531 N609S probably damaging Het
Fkbp4 C T 6: 128,433,231 E256K probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Glrx G A 13: 75,847,299 probably null Het
Gm6614 A T 6: 141,993,642 N208K possibly damaging Het
Gm7356 A T 17: 14,001,464 M101K probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Hectd3 A C 4: 116,999,586 K443N probably damaging Het
Hmcn1 T A 1: 150,664,784 R2925W probably damaging Het
Hspa1a G T 17: 34,970,306 N540K probably damaging Het
Ints6 A T 14: 62,700,786 M649K probably benign Het
Katnb1 T C 8: 95,095,456 V270A possibly damaging Het
Kctd3 A G 1: 188,972,364 S737P probably benign Het
Klra10 T C 6: 130,272,544 probably null Het
Lmtk3 A G 7: 45,798,589 D1353G unknown Het
Lrrk1 A G 7: 66,262,733 V1693A probably damaging Het
Mpnd A T 17: 56,009,575 I85F probably damaging Het
Myo3b A G 2: 70,348,960 T1173A probably benign Het
Myof G A 19: 37,903,831 P1158L probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ncor2 A G 5: 125,110,005 probably benign Het
Npepps C T 11: 97,258,273 probably null Het
Olfr1247 T G 2: 89,609,446 I219L probably damaging Het
Opn5 T A 17: 42,580,749 I266F probably benign Het
P2rx4 A G 5: 122,707,700 D16G probably damaging Het
Padi2 G T 4: 140,917,637 V61L probably benign Het
Pkd1l1 G A 11: 8,863,911 T1480I probably benign Het
Plcb1 T C 2: 135,335,451 S568P probably damaging Het
Rassf10 A G 7: 112,955,707 E505G probably damaging Het
Rcan2 A G 17: 43,836,334 E21G probably benign Het
Rhob G T 12: 8,499,585 C16* probably null Het
Ryr3 T C 2: 112,660,068 N3807S probably damaging Het
Sass6 T A 3: 116,621,397 N519K probably benign Het
Smad9 A T 3: 54,782,443 D28V probably damaging Het
Tepp A T 8: 95,321,266 probably null Het
Tex14 G T 11: 87,514,373 G704C probably benign Het
Tmc3 A G 7: 83,622,316 N892S probably benign Het
Tnfaip2 T A 12: 111,445,663 L166Q probably damaging Het
Triml2 A G 8: 43,185,128 probably null Het
Trio A G 15: 27,856,107 V666A probably benign Het
Tshz2 G T 2: 169,884,664 L393F probably damaging Het
Ttn T G 2: 76,841,771 probably benign Het
Tubb5 A G 17: 35,835,842 Y159H probably damaging Het
Umodl1 A G 17: 30,959,155 Y35C probably damaging Het
Utp4 T C 8: 106,904,446 probably null Het
Vmn1r60 A T 7: 5,544,865 C79S probably damaging Het
Wnt5b T C 6: 119,433,790 T230A probably damaging Het
Zfp618 A T 4: 63,132,706 I575F probably damaging Het
Zmym6 G T 4: 127,123,383 V894L possibly damaging Het
Zpbp T C 11: 11,462,318 probably benign Het
Other mutations in 9530053A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:9530053A07Rik APN 7 28164528 missense probably damaging 1.00
IGL00757:9530053A07Rik APN 7 28154445 missense probably damaging 1.00
IGL01015:9530053A07Rik APN 7 28155318 missense probably damaging 1.00
IGL01079:9530053A07Rik APN 7 28139778 missense probably damaging 0.99
IGL01343:9530053A07Rik APN 7 28150702 missense probably benign 0.19
IGL01420:9530053A07Rik APN 7 28140133 missense probably benign 0.28
IGL01604:9530053A07Rik APN 7 28155324 missense probably benign 0.11
IGL01666:9530053A07Rik APN 7 28153292 missense probably damaging 1.00
IGL02002:9530053A07Rik APN 7 28152796 missense probably damaging 1.00
IGL02036:9530053A07Rik APN 7 28137525 missense possibly damaging 0.82
IGL02126:9530053A07Rik APN 7 28139856 missense probably damaging 1.00
IGL02150:9530053A07Rik APN 7 28146779 nonsense probably null
IGL02219:9530053A07Rik APN 7 28154635 missense probably damaging 1.00
IGL02563:9530053A07Rik APN 7 28157892 missense probably benign
IGL02804:9530053A07Rik APN 7 28153370 missense probably benign 0.00
IGL02830:9530053A07Rik APN 7 28162923 missense probably damaging 1.00
IGL02943:9530053A07Rik APN 7 28147188 missense probably damaging 1.00
IGL02977:9530053A07Rik APN 7 28164372 missense possibly damaging 0.83
IGL03231:9530053A07Rik APN 7 28153722 missense possibly damaging 0.95
IGL03304:9530053A07Rik APN 7 28142242 missense probably damaging 0.99
PIT4378001:9530053A07Rik UTSW 7 28154464 missense possibly damaging 0.61
R0023:9530053A07Rik UTSW 7 28153412 missense probably benign 0.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0132:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0158:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R0230:9530053A07Rik UTSW 7 28156825 missense probably damaging 1.00
R0310:9530053A07Rik UTSW 7 28142274 missense probably benign 0.04
R0448:9530053A07Rik UTSW 7 28140235 missense probably benign 0.03
R0462:9530053A07Rik UTSW 7 28137340 missense probably damaging 1.00
R0481:9530053A07Rik UTSW 7 28153749 missense probably damaging 1.00
R0497:9530053A07Rik UTSW 7 28147465 missense probably damaging 1.00
R0556:9530053A07Rik UTSW 7 28159378 missense probably benign
R0562:9530053A07Rik UTSW 7 28162690 missense probably benign 0.30
R0586:9530053A07Rik UTSW 7 28137091 missense probably damaging 0.99
R0924:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R0930:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R1103:9530053A07Rik UTSW 7 28154520 missense probably damaging 1.00
R1213:9530053A07Rik UTSW 7 28157673 missense probably damaging 1.00
R1292:9530053A07Rik UTSW 7 28142794 splice site probably benign
R1368:9530053A07Rik UTSW 7 28159478 missense possibly damaging 0.89
R1451:9530053A07Rik UTSW 7 28137157 missense probably damaging 1.00
R1477:9530053A07Rik UTSW 7 28157093 missense probably benign 0.01
R1538:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R1655:9530053A07Rik UTSW 7 28147110 missense probably damaging 0.98
R1697:9530053A07Rik UTSW 7 28154347 missense probably damaging 1.00
R1741:9530053A07Rik UTSW 7 28157854 missense probably damaging 0.98
R1796:9530053A07Rik UTSW 7 28155372 missense probably damaging 1.00
R1853:9530053A07Rik UTSW 7 28155546 nonsense probably null
R1861:9530053A07Rik UTSW 7 28154732 missense probably damaging 1.00
R1909:9530053A07Rik UTSW 7 28144348 missense possibly damaging 0.52
R1971:9530053A07Rik UTSW 7 28131512 missense possibly damaging 0.90
R1990:9530053A07Rik UTSW 7 28154360 missense probably damaging 0.98
R2020:9530053A07Rik UTSW 7 28155594 missense probably benign
R2084:9530053A07Rik UTSW 7 28157535 missense probably damaging 1.00
R2125:9530053A07Rik UTSW 7 28158022 missense probably benign 0.00
R2132:9530053A07Rik UTSW 7 28155474 missense probably damaging 1.00
R2513:9530053A07Rik UTSW 7 28131635 missense probably damaging 0.99
R2913:9530053A07Rik UTSW 7 28164307 missense probably damaging 1.00
R3150:9530053A07Rik UTSW 7 28154195 missense probably benign 0.21
R3499:9530053A07Rik UTSW 7 28154555 missense probably benign 0.42
R3702:9530053A07Rik UTSW 7 28157778 missense probably damaging 1.00
R3881:9530053A07Rik UTSW 7 28140038 nonsense probably null
R3938:9530053A07Rik UTSW 7 28154294 missense probably damaging 1.00
R4050:9530053A07Rik UTSW 7 28152985 missense possibly damaging 0.55
R4152:9530053A07Rik UTSW 7 28156897 missense possibly damaging 0.47
R4168:9530053A07Rik UTSW 7 28137109 missense probably benign 0.05
R4235:9530053A07Rik UTSW 7 28156648 missense probably damaging 0.99
R4241:9530053A07Rik UTSW 7 28154335 missense probably damaging 1.00
R4363:9530053A07Rik UTSW 7 28146906 missense probably damaging 1.00
R4460:9530053A07Rik UTSW 7 28152856 missense probably benign 0.17
R4463:9530053A07Rik UTSW 7 28150719 missense probably benign
R4841:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4842:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4876:9530053A07Rik UTSW 7 28142800 intron probably benign
R4905:9530053A07Rik UTSW 7 28156983 missense possibly damaging 0.93
R4997:9530053A07Rik UTSW 7 28143924 missense possibly damaging 0.77
R5091:9530053A07Rik UTSW 7 28156958 missense probably benign 0.44
R5159:9530053A07Rik UTSW 7 28153308 missense probably benign 0.09
R5326:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5396:9530053A07Rik UTSW 7 28140183 missense probably benign
R5441:9530053A07Rik UTSW 7 28156914 missense probably damaging 1.00
R5480:9530053A07Rik UTSW 7 28157999 nonsense probably null
R5542:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5571:9530053A07Rik UTSW 7 28156569 missense probably damaging 0.99
R5613:9530053A07Rik UTSW 7 28142878 intron probably benign
R5637:9530053A07Rik UTSW 7 28152852 missense probably benign 0.00
R5766:9530053A07Rik UTSW 7 28137329 nonsense probably null
R6174:9530053A07Rik UTSW 7 28139959 missense probably damaging 0.96
R6233:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R6250:9530053A07Rik UTSW 7 28150714 missense probably damaging 1.00
R6379:9530053A07Rik UTSW 7 28157592 missense probably damaging 1.00
R6442:9530053A07Rik UTSW 7 28144186 missense possibly damaging 0.88
R6699:9530053A07Rik UTSW 7 28144368 missense probably damaging 1.00
R6852:9530053A07Rik UTSW 7 28147135 missense probably damaging 1.00
R6883:9530053A07Rik UTSW 7 28152835 missense possibly damaging 0.89
R6902:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6903:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6904:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6992:9530053A07Rik UTSW 7 28140183 missense probably benign 0.04
R7023:9530053A07Rik UTSW 7 28140038 nonsense probably null
R7039:9530053A07Rik UTSW 7 28140148 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GTTCACCTAAGTGGCATGGG -3'
(R):5'- TGAATGTCCCTGAACCTGAC -3'

Sequencing Primer
(F):5'- ACCTAAGTGGCATGGGCTTGG -3'
(R):5'- AAGCCTCGAAGTACTGCGTG -3'
Posted On2018-05-21