Incidental Mutation 'R6478:Cchcr1'
ID516943
Institutional Source Beutler Lab
Gene Symbol Cchcr1
Ensembl Gene ENSMUSG00000040312
Gene Namecoiled-coil alpha-helical rod protein 1
SynonymsHcr
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R6478 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35517100-35531015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35524703 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 318 (T318A)
Ref Sequence ENSEMBL: ENSMUSP00000133407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045956] [ENSMUST00000164242] [ENSMUST00000173903]
Predicted Effect probably benign
Transcript: ENSMUST00000045956
AA Change: T235A

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046612
Gene: ENSMUSG00000040312
AA Change: T235A

DomainStartEndE-ValueType
Pfam:HCR 27 767 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164242
AA Change: T235A

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132028
Gene: ENSMUSG00000040312
AA Change: T235A

DomainStartEndE-ValueType
Pfam:HCR 27 767 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173582
Predicted Effect possibly damaging
Transcript: ENSMUST00000173903
AA Change: T318A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133407
Gene: ENSMUSG00000040312
AA Change: T318A

DomainStartEndE-ValueType
Pfam:HCR 110 855 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174827
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 95% (75/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,332 V306A possibly damaging Het
9530053A07Rik C G 7: 28,155,373 P1808R probably damaging Het
Aatk T A 11: 120,010,991 S803C probably benign Het
Abcc9 C T 6: 142,679,308 A454T probably damaging Het
Abr T C 11: 76,452,332 E565G probably damaging Het
Adam33 C A 2: 131,051,346 R753L probably benign Het
Adgre1 A G 17: 57,401,955 T49A possibly damaging Het
AI314180 A T 4: 58,810,785 I1524N probably damaging Het
Ankra2 A T 13: 98,268,442 H153L probably damaging Het
Ankrd26 T G 6: 118,511,638 E1353D probably benign Het
Ankrd52 T G 10: 128,379,331 probably null Het
Arhgef10l T A 4: 140,542,757 T619S possibly damaging Het
Asgr1 T C 11: 70,056,894 V130A possibly damaging Het
Atg10 C A 13: 90,937,347 C161F probably damaging Het
Atm A T 9: 53,490,254 N1438K probably damaging Het
BC107364 T A 3: 96,436,006 probably null Het
Bcar3 G T 3: 122,426,576 A41S probably benign Het
Btbd6 A G 12: 112,977,312 probably benign Het
Celsr1 A T 15: 85,925,518 I2221N probably damaging Het
Cept1 C T 3: 106,533,445 W48* probably null Het
Cfap161 T A 7: 83,793,276 I85L probably benign Het
Clasp1 A T 1: 118,512,180 R640* probably null Het
Col5a1 T A 2: 27,952,436 I441N unknown Het
Col9a1 C A 1: 24,185,405 L223I unknown Het
Dnah2 T C 11: 69,516,010 D223G probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpy19l1 A T 9: 24,450,696 M129K possibly damaging Het
Fcrl1 C A 3: 87,389,639 H318Q probably benign Het
Fer1l5 A G 1: 36,402,531 N609S probably damaging Het
Fkbp4 C T 6: 128,433,231 E256K probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Glrx G A 13: 75,847,299 probably null Het
Gm6614 A T 6: 141,993,642 N208K possibly damaging Het
Gm7356 A T 17: 14,001,464 M101K probably damaging Het
Gstp2 A T 19: 4,040,499 I162N probably benign Het
Hectd3 A C 4: 116,999,586 K443N probably damaging Het
Hmcn1 T A 1: 150,664,784 R2925W probably damaging Het
Hspa1a G T 17: 34,970,306 N540K probably damaging Het
Ints6 A T 14: 62,700,786 M649K probably benign Het
Katnb1 T C 8: 95,095,456 V270A possibly damaging Het
Kctd3 A G 1: 188,972,364 S737P probably benign Het
Klra10 T C 6: 130,272,544 probably null Het
Lmtk3 A G 7: 45,798,589 D1353G unknown Het
Lrrk1 A G 7: 66,262,733 V1693A probably damaging Het
Mpnd A T 17: 56,009,575 I85F probably damaging Het
Myo3b A G 2: 70,348,960 T1173A probably benign Het
Myof G A 19: 37,903,831 P1158L probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ncor2 A G 5: 125,110,005 probably benign Het
Npepps C T 11: 97,258,273 probably null Het
Olfr1247 T G 2: 89,609,446 I219L probably damaging Het
Opn5 T A 17: 42,580,749 I266F probably benign Het
P2rx4 A G 5: 122,707,700 D16G probably damaging Het
Padi2 G T 4: 140,917,637 V61L probably benign Het
Pkd1l1 G A 11: 8,863,911 T1480I probably benign Het
Plcb1 T C 2: 135,335,451 S568P probably damaging Het
Rassf10 A G 7: 112,955,707 E505G probably damaging Het
Rcan2 A G 17: 43,836,334 E21G probably benign Het
Rhob G T 12: 8,499,585 C16* probably null Het
Ryr3 T C 2: 112,660,068 N3807S probably damaging Het
Sass6 T A 3: 116,621,397 N519K probably benign Het
Smad9 A T 3: 54,782,443 D28V probably damaging Het
Tepp A T 8: 95,321,266 probably null Het
Tex14 G T 11: 87,514,373 G704C probably benign Het
Tmc3 A G 7: 83,622,316 N892S probably benign Het
Tnfaip2 T A 12: 111,445,663 L166Q probably damaging Het
Triml2 A G 8: 43,185,128 probably null Het
Trio A G 15: 27,856,107 V666A probably benign Het
Tshz2 G T 2: 169,884,664 L393F probably damaging Het
Ttn T G 2: 76,841,771 probably benign Het
Tubb5 A G 17: 35,835,842 Y159H probably damaging Het
Umodl1 A G 17: 30,959,155 Y35C probably damaging Het
Utp4 T C 8: 106,904,446 probably null Het
Vmn1r60 A T 7: 5,544,865 C79S probably damaging Het
Wnt5b T C 6: 119,433,790 T230A probably damaging Het
Zfp618 A T 4: 63,132,706 I575F probably damaging Het
Zmym6 G T 4: 127,123,383 V894L possibly damaging Het
Zpbp T C 11: 11,462,318 probably benign Het
Other mutations in Cchcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Cchcr1 APN 17 35528572 missense possibly damaging 0.92
IGL02723:Cchcr1 APN 17 35530802 missense probably benign 0.00
IGL02806:Cchcr1 APN 17 35525256 splice site probably benign
IGL03055:Cchcr1 UTSW 17 35526619 missense probably benign 0.33
R0569:Cchcr1 UTSW 17 35528968 critical splice donor site probably null
R1438:Cchcr1 UTSW 17 35530560 critical splice donor site probably null
R2055:Cchcr1 UTSW 17 35526420 missense probably damaging 1.00
R2511:Cchcr1 UTSW 17 35530513 missense probably benign 0.01
R3910:Cchcr1 UTSW 17 35525336 missense probably damaging 1.00
R3911:Cchcr1 UTSW 17 35525336 missense probably damaging 1.00
R3913:Cchcr1 UTSW 17 35525336 missense probably damaging 1.00
R5590:Cchcr1 UTSW 17 35526680 missense probably damaging 1.00
R5821:Cchcr1 UTSW 17 35528848 missense probably damaging 1.00
R5940:Cchcr1 UTSW 17 35524993 missense probably damaging 1.00
R5941:Cchcr1 UTSW 17 35524993 missense probably damaging 1.00
R6006:Cchcr1 UTSW 17 35524700 missense possibly damaging 0.83
R6114:Cchcr1 UTSW 17 35525330 missense probably damaging 0.98
R6146:Cchcr1 UTSW 17 35528578 missense possibly damaging 0.92
R6262:Cchcr1 UTSW 17 35530516 missense probably benign 0.04
R6369:Cchcr1 UTSW 17 35528176 missense probably damaging 0.99
R6827:Cchcr1 UTSW 17 35530405 missense possibly damaging 0.71
R6860:Cchcr1 UTSW 17 35529118 missense possibly damaging 0.85
R7109:Cchcr1 UTSW 17 35517941 critical splice donor site probably null
R7276:Cchcr1 UTSW 17 35529134 missense possibly damaging 0.46
X0025:Cchcr1 UTSW 17 35526676 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCTCTGAATAGCCTGGAAACG -3'
(R):5'- ATCTCCATGCTACCTCAGGC -3'

Sequencing Primer
(F):5'- CTCTGAATAGCCTGGAAACGAAACG -3'
(R):5'- TCAAGGGCAGCATGGCTTC -3'
Posted On2018-05-21