Incidental Mutation 'R6479:Myo3a'
ID516954
Institutional Source Beutler Lab
Gene Symbol Myo3a
Ensembl Gene ENSMUSG00000025716
Gene Namemyosin IIIA
Synonyms9030416P08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R6479 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location22227503-22618252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22577865 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 377 (V377A)
Ref Sequence ENSEMBL: ENSMUSP00000116185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000138863]
Predicted Effect probably benign
Transcript: ENSMUST00000044749
AA Change: V1315A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: V1315A

DomainStartEndE-ValueType
S_TKc 29 295 1.62e-91 SMART
MYSc 340 1061 2.07e-252 SMART
IQ 1061 1083 2.88e1 SMART
IQ 1088 1110 9.48e-3 SMART
low complexity region 1153 1169 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
low complexity region 1496 1505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138863
AA Change: V377A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116185
Gene: ENSMUSG00000025716
AA Change: V377A

DomainStartEndE-ValueType
Pfam:Myosin_head 1 110 1.7e-28 PFAM
IQ 123 145 2.88e1 SMART
IQ 150 172 9.48e-3 SMART
low complexity region 215 231 N/A INTRINSIC
low complexity region 421 431 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149423
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.0%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A C 8: 24,629,665 S533A probably benign Het
Akap6 T G 12: 53,141,169 S1789A probably damaging Het
Alox15 A G 11: 70,345,185 S519P probably damaging Het
Anapc2 A G 2: 25,285,395 K816E probably benign Het
Atp6v1a T C 16: 44,098,758 D488G probably benign Het
Banp A G 8: 121,991,437 probably null Het
Camsap1 A G 2: 25,935,862 C1367R possibly damaging Het
Casz1 C A 4: 148,937,078 H539Q probably damaging Het
Ccl5 A G 11: 83,530,386 Y26H probably benign Het
Cops3 A T 11: 59,833,072 S86R probably benign Het
Cts7 A G 13: 61,355,641 S170P probably benign Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Dennd1b C T 1: 139,041,960 probably benign Het
Dicer1 T C 12: 104,696,723 D1533G probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock4 A G 12: 40,828,955 E1531G probably damaging Het
Erap1 A G 13: 74,663,493 probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gm10309 A T 17: 86,504,579 M1K probably null Het
Gm21994 C T 2: 150,254,591 G306D probably damaging Het
Gm4450 T A 3: 98,446,841 E114V possibly damaging Het
Gm4884 A T 7: 41,040,787 N36Y probably damaging Het
Hmcn1 G A 1: 150,677,302 R2546* probably null Het
Hmcn2 A G 2: 31,425,468 D3743G probably damaging Het
Irak2 A T 6: 113,686,941 N423Y probably damaging Het
Jarid2 G A 13: 44,848,289 G26D probably benign Het
Kif13b A G 14: 64,751,525 K785R probably benign Het
Lamc3 A T 2: 31,887,401 I20F probably benign Het
Limk1 G A 5: 134,661,519 probably benign Het
Lrp4 C T 2: 91,487,084 T851I probably damaging Het
Med13 G A 11: 86,357,527 probably benign Het
Megf10 T C 18: 57,246,570 F273L possibly damaging Het
Meltf T A 16: 31,881,882 D73E probably damaging Het
Mroh7 A G 4: 106,703,188 F640L possibly damaging Het
Mtor T C 4: 148,551,000 S2448P probably benign Het
Myo5b T C 18: 74,617,015 V183A probably damaging Het
Nedd4l G A 18: 65,209,681 R755H probably damaging Het
Nrde2 T C 12: 100,143,948 T275A probably benign Het
Olfr658 A G 7: 104,645,126 I80T probably benign Het
Osgepl1 T C 1: 53,321,543 V381A probably benign Het
Pcdha1 C T 18: 36,931,456 T391I probably benign Het
Pdp1 T C 4: 11,961,327 N328S probably damaging Het
Pepd A G 7: 35,040,722 E340G probably benign Het
Plch1 T C 3: 63,744,510 T387A probably benign Het
Plxnb1 C A 9: 109,111,665 T1536K possibly damaging Het
Rbp7 T C 4: 149,449,890 T130A probably benign Het
Rhot2 A T 17: 25,841,080 V309E probably benign Het
Slc37a1 A G 17: 31,338,990 I421M possibly damaging Het
Slit2 T A 5: 48,231,989 L585H probably damaging Het
Spint4 C A 2: 164,700,844 A119D probably benign Het
Strip2 G T 6: 29,944,497 probably null Het
Stxbp4 T C 11: 90,619,187 Y59C probably damaging Het
Syne1 G A 10: 5,231,679 Q4219* probably null Het
Syne1 A T 10: 5,456,826 I37N probably damaging Het
Syne4 G T 7: 30,316,915 G179* probably null Het
Tead1 T C 7: 112,861,465 V192A probably benign Het
Trim37 G T 11: 87,216,487 E317* probably null Het
Wdfy3 A C 5: 101,913,179 Y1390D probably damaging Het
Wdr81 A G 11: 75,452,105 F779L possibly damaging Het
Other mutations in Myo3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Myo3a APN 2 22332473 missense probably benign 0.42
IGL01307:Myo3a APN 2 22558289 missense probably damaging 1.00
IGL01413:Myo3a APN 2 22297600 missense probably benign 0.25
IGL01655:Myo3a APN 2 22423326 missense probably damaging 1.00
IGL01767:Myo3a APN 2 22423222 missense probably damaging 0.96
IGL01803:Myo3a APN 2 22241115 missense probably damaging 1.00
IGL01969:Myo3a APN 2 22297688 missense probably benign 0.03
IGL02043:Myo3a APN 2 22399965 missense probably benign 0.01
IGL02124:Myo3a APN 2 22577526 missense probably benign 0.01
IGL02174:Myo3a APN 2 22332393 missense probably benign 0.04
IGL02649:Myo3a APN 2 22323607 missense probably benign
IGL02976:Myo3a APN 2 22542452 nonsense probably null
IGL03328:Myo3a APN 2 22578198 missense probably benign 0.02
IGL03376:Myo3a APN 2 22600074 splice site probably benign
A5278:Myo3a UTSW 2 22323653 missense probably benign 0.27
PIT4445001:Myo3a UTSW 2 22542415 missense possibly damaging 0.64
R0008:Myo3a UTSW 2 22579741 missense probably damaging 0.99
R0099:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0212:Myo3a UTSW 2 22291848 missense probably damaging 1.00
R0281:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0282:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0492:Myo3a UTSW 2 22323636 missense possibly damaging 0.46
R0498:Myo3a UTSW 2 22577429 missense possibly damaging 0.74
R0594:Myo3a UTSW 2 22544332 splice site probably benign
R0609:Myo3a UTSW 2 22333513 missense probably benign 0.29
R0609:Myo3a UTSW 2 22396299 missense possibly damaging 0.95
R0827:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R0968:Myo3a UTSW 2 22558289 missense probably damaging 1.00
R1157:Myo3a UTSW 2 22542414 critical splice acceptor site probably null
R1301:Myo3a UTSW 2 22267095 splice site probably benign
R1352:Myo3a UTSW 2 22323675 critical splice donor site probably null
R1443:Myo3a UTSW 2 22282626 missense probably damaging 0.99
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1517:Myo3a UTSW 2 22282634 missense probably damaging 0.99
R1565:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1712:Myo3a UTSW 2 22564992 missense probably damaging 1.00
R1722:Myo3a UTSW 2 22399827 missense probably benign 0.03
R1822:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1823:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1824:Myo3a UTSW 2 22396243 missense probably benign
R1837:Myo3a UTSW 2 22577592 missense possibly damaging 0.76
R1867:Myo3a UTSW 2 22399846 missense probably benign 0.00
R1917:Myo3a UTSW 2 22291922 missense probably damaging 1.00
R1920:Myo3a UTSW 2 22564996 missense probably benign 0.02
R1937:Myo3a UTSW 2 22396315 missense probably damaging 1.00
R1954:Myo3a UTSW 2 22241226 missense probably damaging 1.00
R1988:Myo3a UTSW 2 22578128 missense possibly damaging 0.86
R2091:Myo3a UTSW 2 22333677 missense probably damaging 0.99
R2115:Myo3a UTSW 2 22245531 missense probably damaging 1.00
R2125:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2126:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2216:Myo3a UTSW 2 22577771 missense probably benign 0.00
R2413:Myo3a UTSW 2 22577912 missense probably benign 0.00
R2964:Myo3a UTSW 2 22340256 missense possibly damaging 0.90
R3196:Myo3a UTSW 2 22399868 missense possibly damaging 0.86
R3837:Myo3a UTSW 2 22565109 splice site probably benign
R3905:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R3926:Myo3a UTSW 2 22565041 missense probably damaging 0.99
R4014:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4015:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4017:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4043:Myo3a UTSW 2 22333539 splice site probably benign
R4044:Myo3a UTSW 2 22577700 missense probably damaging 0.99
R4057:Myo3a UTSW 2 22266160 missense probably benign 0.01
R4192:Myo3a UTSW 2 22407377 missense probably damaging 1.00
R4282:Myo3a UTSW 2 22340278 missense probably benign 0.14
R4321:Myo3a UTSW 2 22267155 missense probably damaging 1.00
R4393:Myo3a UTSW 2 22577854 missense probably damaging 0.99
R4398:Myo3a UTSW 2 22577842 missense probably benign
R4446:Myo3a UTSW 2 22600137 missense probably damaging 1.00
R4685:Myo3a UTSW 2 22407422 missense probably damaging 1.00
R5032:Myo3a UTSW 2 22282602 missense probably damaging 1.00
R5096:Myo3a UTSW 2 22574242 missense probably benign 0.16
R5183:Myo3a UTSW 2 22578158 missense probably benign 0.05
R5458:Myo3a UTSW 2 22245550 missense probably damaging 1.00
R5502:Myo3a UTSW 2 22558369 missense probably damaging 1.00
R5522:Myo3a UTSW 2 22574341 missense probably damaging 1.00
R6462:Myo3a UTSW 2 22558411 missense probably damaging 1.00
R6513:Myo3a UTSW 2 22407332 missense probably damaging 1.00
R6520:Myo3a UTSW 2 22399926 missense possibly damaging 0.90
R6602:Myo3a UTSW 2 22577787 missense probably damaging 0.96
R6671:Myo3a UTSW 2 22294522 missense probably damaging 1.00
R6743:Myo3a UTSW 2 22361664 missense probably benign 0.24
R6865:Myo3a UTSW 2 22574301 missense probably benign 0.00
R6961:Myo3a UTSW 2 22245558 missense probably benign 0.00
R7001:Myo3a UTSW 2 22332377 missense probably benign 0.04
R7215:Myo3a UTSW 2 22245567 missense not run
R7301:Myo3a UTSW 2 22544466 critical splice donor site unknown
R7318:Myo3a UTSW 2 22558320 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCAGAGTTACTGTCAGTGGTAC -3'
(R):5'- TCTTAAAGGGAGGTGCCAGC -3'

Sequencing Primer
(F):5'- TACACAGAGGGAAGCAACTTTG -3'
(R):5'- AGGTGCCAGCCTGTCCTTTC -3'
Posted On2018-05-21