Incidental Mutation 'R6479:Limk1'
ID516973
Institutional Source Beutler Lab
Gene Symbol Limk1
Ensembl Gene ENSMUSG00000029674
Gene NameLIM-domain containing, protein kinase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6479 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location134656039-134688598 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) G to A at 134661519 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000015137] [ENSMUST00000111233] [ENSMUST00000138590]
Predicted Effect probably benign
Transcript: ENSMUST00000015137
SMART Domains Protein: ENSMUSP00000015137
Gene: ENSMUSG00000029674

DomainStartEndE-ValueType
LIM 24 75 5.3e-19 SMART
LIM 83 137 1.73e-9 SMART
PDZ 176 258 1.51e-9 SMART
low complexity region 266 277 N/A INTRINSIC
Pfam:Pkinase 339 604 1.7e-49 PFAM
Pfam:Pkinase_Tyr 339 604 1.5e-55 PFAM
Pfam:Kdo 345 509 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111233
SMART Domains Protein: ENSMUSP00000106864
Gene: ENSMUSG00000029674

DomainStartEndE-ValueType
LIM 23 67 2.19e-1 SMART
LIM 75 129 1.73e-9 SMART
PDZ 168 250 1.51e-9 SMART
low complexity region 258 269 N/A INTRINSIC
Pfam:Pkinase_Tyr 331 596 1.5e-56 PFAM
Pfam:Pkinase 331 597 4.7e-50 PFAM
Pfam:Kdo 339 501 1.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134093
SMART Domains Protein: ENSMUSP00000121718
Gene: ENSMUSG00000029674

DomainStartEndE-ValueType
LIM 16 60 2.19e-1 SMART
LIM 68 122 1.73e-9 SMART
PDZ 161 243 1.51e-9 SMART
low complexity region 251 262 N/A INTRINSIC
Pfam:Pkinase 324 425 3.9e-16 PFAM
Pfam:Pkinase_Tyr 324 434 5.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137897
Predicted Effect unknown
Transcript: ENSMUST00000138590
AA Change: T61I
SMART Domains Protein: ENSMUSP00000118268
Gene: ENSMUSG00000029674
AA Change: T61I

DomainStartEndE-ValueType
Pfam:Pkinase 3 59 3.6e-9 PFAM
Pfam:Pkinase_Tyr 3 80 2.6e-13 PFAM
Meta Mutation Damage Score 0.0532 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.0%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: This gene encodes a member of the LIM kinase family of proteins. This protein is a serine/threonine kinase that regulates actin polymerization via phosphorylation and inactivation of the actin binding factor cofilin. This protein also stimulates axon growth and may play a role in brain development. Homozygous knockout mice for this gene exhibit reduced bone mass, abnormal neuronal morphology and altered synaptic function. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display an abnormal actin cytoskeleton in neurons of the central nervous system and structural abnormalities of the dendritic spines. Long term potentiation is altered and behavioral anomalies are seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A C 8: 24,629,665 S533A probably benign Het
Akap6 T G 12: 53,141,169 S1789A probably damaging Het
Alox15 A G 11: 70,345,185 S519P probably damaging Het
Anapc2 A G 2: 25,285,395 K816E probably benign Het
Atp6v1a T C 16: 44,098,758 D488G probably benign Het
Banp A G 8: 121,991,437 probably null Het
Camsap1 A G 2: 25,935,862 C1367R possibly damaging Het
Casz1 C A 4: 148,937,078 H539Q probably damaging Het
Ccl5 A G 11: 83,530,386 Y26H probably benign Het
Cops3 A T 11: 59,833,072 S86R probably benign Het
Cts7 A G 13: 61,355,641 S170P probably benign Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Dennd1b C T 1: 139,041,960 probably benign Het
Dicer1 T C 12: 104,696,723 D1533G probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock4 A G 12: 40,828,955 E1531G probably damaging Het
Erap1 A G 13: 74,663,493 probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gm10309 A T 17: 86,504,579 M1K probably null Het
Gm21994 C T 2: 150,254,591 G306D probably damaging Het
Gm4450 T A 3: 98,446,841 E114V possibly damaging Het
Gm4884 A T 7: 41,040,787 N36Y probably damaging Het
Hmcn1 G A 1: 150,677,302 R2546* probably null Het
Hmcn2 A G 2: 31,425,468 D3743G probably damaging Het
Irak2 A T 6: 113,686,941 N423Y probably damaging Het
Jarid2 G A 13: 44,848,289 G26D probably benign Het
Kif13b A G 14: 64,751,525 K785R probably benign Het
Lamc3 A T 2: 31,887,401 I20F probably benign Het
Lrp4 C T 2: 91,487,084 T851I probably damaging Het
Med13 G A 11: 86,357,527 probably benign Het
Megf10 T C 18: 57,246,570 F273L possibly damaging Het
Meltf T A 16: 31,881,882 D73E probably damaging Het
Mroh7 A G 4: 106,703,188 F640L possibly damaging Het
Mtor T C 4: 148,551,000 S2448P probably benign Het
Myo3a T C 2: 22,577,865 V377A probably benign Het
Myo5b T C 18: 74,617,015 V183A probably damaging Het
Nedd4l G A 18: 65,209,681 R755H probably damaging Het
Nrde2 T C 12: 100,143,948 T275A probably benign Het
Olfr658 A G 7: 104,645,126 I80T probably benign Het
Osgepl1 T C 1: 53,321,543 V381A probably benign Het
Pcdha1 C T 18: 36,931,456 T391I probably benign Het
Pdp1 T C 4: 11,961,327 N328S probably damaging Het
Pepd A G 7: 35,040,722 E340G probably benign Het
Plch1 T C 3: 63,744,510 T387A probably benign Het
Plxnb1 C A 9: 109,111,665 T1536K possibly damaging Het
Rbp7 T C 4: 149,449,890 T130A probably benign Het
Rhot2 A T 17: 25,841,080 V309E probably benign Het
Slc37a1 A G 17: 31,338,990 I421M possibly damaging Het
Slit2 T A 5: 48,231,989 L585H probably damaging Het
Spint4 C A 2: 164,700,844 A119D probably benign Het
Strip2 G T 6: 29,944,497 probably null Het
Stxbp4 T C 11: 90,619,187 Y59C probably damaging Het
Syne1 G A 10: 5,231,679 Q4219* probably null Het
Syne1 A T 10: 5,456,826 I37N probably damaging Het
Syne4 G T 7: 30,316,915 G179* probably null Het
Tead1 T C 7: 112,861,465 V192A probably benign Het
Trim37 G T 11: 87,216,487 E317* probably null Het
Wdfy3 A C 5: 101,913,179 Y1390D probably damaging Het
Wdr81 A G 11: 75,452,105 F779L possibly damaging Het
Other mutations in Limk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Limk1 APN 5 134657900 unclassified probably benign
IGL02029:Limk1 APN 5 134657954 nonsense probably null
IGL02211:Limk1 APN 5 134657637 missense probably damaging 1.00
IGL03000:Limk1 APN 5 134670501 missense probably damaging 0.99
extremist UTSW 5 134670441 missense probably damaging 1.00
R0046:Limk1 UTSW 5 134672761 missense probably damaging 1.00
R0046:Limk1 UTSW 5 134672761 missense probably damaging 1.00
R0058:Limk1 UTSW 5 134659871 missense probably damaging 1.00
R0058:Limk1 UTSW 5 134659871 missense probably damaging 1.00
R0071:Limk1 UTSW 5 134661391 missense probably benign 0.01
R0180:Limk1 UTSW 5 134669261 missense probably damaging 0.97
R1456:Limk1 UTSW 5 134657510 missense probably benign 0.09
R2225:Limk1 UTSW 5 134661556 splice site probably null
R2379:Limk1 UTSW 5 134679481 unclassified probably benign
R2899:Limk1 UTSW 5 134688300 intron probably null
R3423:Limk1 UTSW 5 134672669 critical splice donor site probably null
R4235:Limk1 UTSW 5 134670478 missense probably benign 0.00
R4516:Limk1 UTSW 5 134676786 intron probably benign
R4566:Limk1 UTSW 5 134686683 missense probably benign 0.12
R4752:Limk1 UTSW 5 134670441 missense probably damaging 1.00
R5682:Limk1 UTSW 5 134665205 critical splice donor site probably null
R5917:Limk1 UTSW 5 134657935 missense probably damaging 1.00
R6163:Limk1 UTSW 5 134657955 missense probably damaging 1.00
R6952:Limk1 UTSW 5 134670478 missense possibly damaging 0.76
R7009:Limk1 UTSW 5 134672699 missense probably benign
R7147:Limk1 UTSW 5 134657341 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TATGGGAGCAGGACTCTAGG -3'
(R):5'- TTTCAGGGCTTCCACTAGAGG -3'

Sequencing Primer
(F):5'- AGCAGGACTCTAGGCACTTG -3'
(R):5'- GCTTCCACTAGAGGTCAGGTG -3'
Posted On2018-05-21