Incidental Mutation 'R6479:Olfr658'
ID516978
Institutional Source Beutler Lab
Gene Symbol Olfr658
Ensembl Gene ENSMUSG00000070421
Gene Nameolfactory receptor 658
SynonymsGA_x6K02T2PBJ9-7273558-7272587, MOR34-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.015) question?
Stock #R6479 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104642877-104647305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104645126 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 80 (I80T)
Ref Sequence ENSEMBL: ENSMUSP00000147498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089296] [ENSMUST00000210641]
Predicted Effect probably benign
Transcript: ENSMUST00000089296
AA Change: I82T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000086711
Gene: ENSMUSG00000070421
AA Change: I82T

DomainStartEndE-ValueType
Pfam:7tm_4 35 315 1.9e-108 PFAM
Pfam:7TM_GPCR_Srsx 39 256 3.1e-9 PFAM
Pfam:7tm_1 45 297 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210641
AA Change: I80T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.0%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A C 8: 24,629,665 S533A probably benign Het
Akap6 T G 12: 53,141,169 S1789A probably damaging Het
Alox15 A G 11: 70,345,185 S519P probably damaging Het
Anapc2 A G 2: 25,285,395 K816E probably benign Het
Atp6v1a T C 16: 44,098,758 D488G probably benign Het
Banp A G 8: 121,991,437 probably null Het
Camsap1 A G 2: 25,935,862 C1367R possibly damaging Het
Casz1 C A 4: 148,937,078 H539Q probably damaging Het
Ccl5 A G 11: 83,530,386 Y26H probably benign Het
Cops3 A T 11: 59,833,072 S86R probably benign Het
Cts7 A G 13: 61,355,641 S170P probably benign Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Dennd1b C T 1: 139,041,960 probably benign Het
Dicer1 T C 12: 104,696,723 D1533G probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock4 A G 12: 40,828,955 E1531G probably damaging Het
Erap1 A G 13: 74,663,493 probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gm10309 A T 17: 86,504,579 M1K probably null Het
Gm21994 C T 2: 150,254,591 G306D probably damaging Het
Gm4450 T A 3: 98,446,841 E114V possibly damaging Het
Gm4884 A T 7: 41,040,787 N36Y probably damaging Het
Hmcn1 G A 1: 150,677,302 R2546* probably null Het
Hmcn2 A G 2: 31,425,468 D3743G probably damaging Het
Irak2 A T 6: 113,686,941 N423Y probably damaging Het
Jarid2 G A 13: 44,848,289 G26D probably benign Het
Kif13b A G 14: 64,751,525 K785R probably benign Het
Lamc3 A T 2: 31,887,401 I20F probably benign Het
Limk1 G A 5: 134,661,519 probably benign Het
Lrp4 C T 2: 91,487,084 T851I probably damaging Het
Med13 G A 11: 86,357,527 probably benign Het
Megf10 T C 18: 57,246,570 F273L possibly damaging Het
Meltf T A 16: 31,881,882 D73E probably damaging Het
Mroh7 A G 4: 106,703,188 F640L possibly damaging Het
Mtor T C 4: 148,551,000 S2448P probably benign Het
Myo3a T C 2: 22,577,865 V377A probably benign Het
Myo5b T C 18: 74,617,015 V183A probably damaging Het
Nedd4l G A 18: 65,209,681 R755H probably damaging Het
Nrde2 T C 12: 100,143,948 T275A probably benign Het
Osgepl1 T C 1: 53,321,543 V381A probably benign Het
Pcdha1 C T 18: 36,931,456 T391I probably benign Het
Pdp1 T C 4: 11,961,327 N328S probably damaging Het
Pepd A G 7: 35,040,722 E340G probably benign Het
Plch1 T C 3: 63,744,510 T387A probably benign Het
Plxnb1 C A 9: 109,111,665 T1536K possibly damaging Het
Rbp7 T C 4: 149,449,890 T130A probably benign Het
Rhot2 A T 17: 25,841,080 V309E probably benign Het
Slc37a1 A G 17: 31,338,990 I421M possibly damaging Het
Slit2 T A 5: 48,231,989 L585H probably damaging Het
Spint4 C A 2: 164,700,844 A119D probably benign Het
Strip2 G T 6: 29,944,497 probably null Het
Stxbp4 T C 11: 90,619,187 Y59C probably damaging Het
Syne1 G A 10: 5,231,679 Q4219* probably null Het
Syne1 A T 10: 5,456,826 I37N probably damaging Het
Syne4 G T 7: 30,316,915 G179* probably null Het
Tead1 T C 7: 112,861,465 V192A probably benign Het
Trim37 G T 11: 87,216,487 E317* probably null Het
Wdfy3 A C 5: 101,913,179 Y1390D probably damaging Het
Wdr81 A G 11: 75,452,105 F779L possibly damaging Het
Other mutations in Olfr658
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Olfr658 APN 7 104644480 nonsense probably null
IGL01408:Olfr658 APN 7 104644929 missense possibly damaging 0.61
IGL02612:Olfr658 APN 7 104644663 missense probably benign 0.00
R0241:Olfr658 UTSW 7 104645243 missense probably benign 0.00
R0241:Olfr658 UTSW 7 104645243 missense probably benign 0.00
R1171:Olfr658 UTSW 7 104644997 missense probably damaging 1.00
R1465:Olfr658 UTSW 7 104644946 missense probably benign 0.13
R1465:Olfr658 UTSW 7 104644946 missense probably benign 0.13
R1568:Olfr658 UTSW 7 104644770 missense probably benign 0.28
R1866:Olfr658 UTSW 7 104644797 missense probably benign 0.35
R4061:Olfr658 UTSW 7 104644473 nonsense probably null
R4233:Olfr658 UTSW 7 104644988 missense probably benign 0.15
R6080:Olfr658 UTSW 7 104645310 missense probably benign 0.01
R7222:Olfr658 UTSW 7 104644730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAGCAGAACGCCCCTCAG -3'
(R):5'- AGACATGCACATCTGGATCTC -3'

Sequencing Primer
(F):5'- CCAATCTTGGCAATGATAGGATTGG -3'
(R):5'- ACATGCACATCTGGATCTCCTTCC -3'
Posted On2018-05-21