Incidental Mutation 'R6479:Tead1'
ID516979
Institutional Source Beutler Lab
Gene Symbol Tead1
Ensembl Gene ENSMUSG00000055320
Gene NameTEA domain family member 1
SynonymsGtrgeo5, mTEF-1, 2610024B07Rik, TEAD-1, B230114H05Rik, TEF-1, Tcf13
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6479 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location112679318-112906807 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112861465 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 192 (V192A)
Ref Sequence ENSEMBL: ENSMUSP00000128439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059768] [ENSMUST00000069256] [ENSMUST00000084705] [ENSMUST00000106638] [ENSMUST00000164363] [ENSMUST00000165036] [ENSMUST00000168981] [ENSMUST00000170352] [ENSMUST00000171197]
Predicted Effect probably benign
Transcript: ENSMUST00000059768
AA Change: V213A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060671
Gene: ENSMUSG00000055320
AA Change: V213A

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
Pfam:TEA 95 428 3e-127 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069256
AA Change: V188A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130459
Gene: ENSMUSG00000055320
AA Change: V188A

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
low complexity region 128 144 N/A INTRINSIC
PDB:3KYS|C 194 411 1e-153 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000084705
AA Change: V188A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000081755
Gene: ENSMUSG00000055320
AA Change: V188A

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
low complexity region 128 144 N/A INTRINSIC
PDB:3KYS|C 194 411 1e-153 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000106638
AA Change: V192A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102249
Gene: ENSMUSG00000055320
AA Change: V192A

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
low complexity region 132 148 N/A INTRINSIC
PDB:3KYS|C 198 415 1e-153 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000164363
AA Change: V213A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127574
Gene: ENSMUSG00000055320
AA Change: V213A

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
internal_repeat_1 95 119 8.98e-7 PROSPERO
low complexity region 153 169 N/A INTRINSIC
PDB:3KYS|C 219 436 1e-153 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000165036
AA Change: V192A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131221
Gene: ENSMUSG00000055320
AA Change: V192A

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
low complexity region 132 148 N/A INTRINSIC
PDB:3KYS|C 198 415 1e-153 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167060
SMART Domains Protein: ENSMUSP00000130564
Gene: ENSMUSG00000055320

DomainStartEndE-ValueType
Pfam:TEA 1 128 1.8e-28 PFAM
low complexity region 132 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168981
AA Change: V171A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133025
Gene: ENSMUSG00000055320
AA Change: V171A

DomainStartEndE-ValueType
Pfam:TEA 1 386 7.1e-166 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170352
AA Change: V167A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129798
Gene: ENSMUSG00000055320
AA Change: V167A

DomainStartEndE-ValueType
Pfam:TEA 1 382 4.5e-163 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171197
AA Change: V192A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128439
Gene: ENSMUSG00000055320
AA Change: V192A

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
low complexity region 132 148 N/A INTRINSIC
Pfam:TEA 222 349 3e-59 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.0%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitous transcriptional enhancer factor that is a member of the TEA/ATTS domain family. This protein directs the transactivation of a wide variety of genes and, in placental cells, also acts as a transcriptional repressor. Mutations in this gene cause Sveinsson's chorioretinal atrophy. Additional transcript variants have been described but their full-length natures have not been experimentally verified. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene die between embryonic day 11 and 12.5. Abnormalities were seen in heart development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A C 8: 24,629,665 S533A probably benign Het
Akap6 T G 12: 53,141,169 S1789A probably damaging Het
Alox15 A G 11: 70,345,185 S519P probably damaging Het
Anapc2 A G 2: 25,285,395 K816E probably benign Het
Atp6v1a T C 16: 44,098,758 D488G probably benign Het
Banp A G 8: 121,991,437 probably null Het
Camsap1 A G 2: 25,935,862 C1367R possibly damaging Het
Casz1 C A 4: 148,937,078 H539Q probably damaging Het
Ccl5 A G 11: 83,530,386 Y26H probably benign Het
Cops3 A T 11: 59,833,072 S86R probably benign Het
Cts7 A G 13: 61,355,641 S170P probably benign Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Dennd1b C T 1: 139,041,960 probably benign Het
Dicer1 T C 12: 104,696,723 D1533G probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock4 A G 12: 40,828,955 E1531G probably damaging Het
Erap1 A G 13: 74,663,493 probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gm10309 A T 17: 86,504,579 M1K probably null Het
Gm21994 C T 2: 150,254,591 G306D probably damaging Het
Gm4450 T A 3: 98,446,841 E114V possibly damaging Het
Gm4884 A T 7: 41,040,787 N36Y probably damaging Het
Hmcn1 G A 1: 150,677,302 R2546* probably null Het
Hmcn2 A G 2: 31,425,468 D3743G probably damaging Het
Irak2 A T 6: 113,686,941 N423Y probably damaging Het
Jarid2 G A 13: 44,848,289 G26D probably benign Het
Kif13b A G 14: 64,751,525 K785R probably benign Het
Lamc3 A T 2: 31,887,401 I20F probably benign Het
Limk1 G A 5: 134,661,519 probably benign Het
Lrp4 C T 2: 91,487,084 T851I probably damaging Het
Med13 G A 11: 86,357,527 probably benign Het
Megf10 T C 18: 57,246,570 F273L possibly damaging Het
Meltf T A 16: 31,881,882 D73E probably damaging Het
Mroh7 A G 4: 106,703,188 F640L possibly damaging Het
Mtor T C 4: 148,551,000 S2448P probably benign Het
Myo3a T C 2: 22,577,865 V377A probably benign Het
Myo5b T C 18: 74,617,015 V183A probably damaging Het
Nedd4l G A 18: 65,209,681 R755H probably damaging Het
Nrde2 T C 12: 100,143,948 T275A probably benign Het
Olfr658 A G 7: 104,645,126 I80T probably benign Het
Osgepl1 T C 1: 53,321,543 V381A probably benign Het
Pcdha1 C T 18: 36,931,456 T391I probably benign Het
Pdp1 T C 4: 11,961,327 N328S probably damaging Het
Pepd A G 7: 35,040,722 E340G probably benign Het
Plch1 T C 3: 63,744,510 T387A probably benign Het
Plxnb1 C A 9: 109,111,665 T1536K possibly damaging Het
Rbp7 T C 4: 149,449,890 T130A probably benign Het
Rhot2 A T 17: 25,841,080 V309E probably benign Het
Slc37a1 A G 17: 31,338,990 I421M possibly damaging Het
Slit2 T A 5: 48,231,989 L585H probably damaging Het
Spint4 C A 2: 164,700,844 A119D probably benign Het
Strip2 G T 6: 29,944,497 probably null Het
Stxbp4 T C 11: 90,619,187 Y59C probably damaging Het
Syne1 G A 10: 5,231,679 Q4219* probably null Het
Syne1 A T 10: 5,456,826 I37N probably damaging Het
Syne4 G T 7: 30,316,915 G179* probably null Het
Trim37 G T 11: 87,216,487 E317* probably null Het
Wdfy3 A C 5: 101,913,179 Y1390D probably damaging Het
Wdr81 A G 11: 75,452,105 F779L possibly damaging Het
Other mutations in Tead1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Tead1 APN 7 112839455 missense probably damaging 1.00
IGL00678:Tead1 APN 7 112841880 splice site probably null
IGL02640:Tead1 APN 7 112861456 missense probably benign 0.09
R0635:Tead1 UTSW 7 112891706 splice site probably benign
R1469:Tead1 UTSW 7 112876184 missense probably damaging 1.00
R1469:Tead1 UTSW 7 112876184 missense probably damaging 1.00
R1981:Tead1 UTSW 7 112891745 missense probably benign 0.03
R2679:Tead1 UTSW 7 112856846 missense probably damaging 1.00
R2866:Tead1 UTSW 7 112759487 missense probably damaging 0.98
R4060:Tead1 UTSW 7 112876062 splice site probably null
R4810:Tead1 UTSW 7 112841866 intron probably null
R5253:Tead1 UTSW 7 112861545 missense probably damaging 1.00
R5266:Tead1 UTSW 7 112759466 utr 5 prime probably benign
R6316:Tead1 UTSW 7 112891839 missense probably damaging 1.00
R6562:Tead1 UTSW 7 112861443 missense probably benign
R7178:Tead1 UTSW 7 112841937 missense probably benign 0.00
R7207:Tead1 UTSW 7 112842080 missense possibly damaging 0.78
X0028:Tead1 UTSW 7 112859116 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CAGTCTGCTTAGCTGTCACTG -3'
(R):5'- TACACAGGGCATTTCACACAGG -3'

Sequencing Primer
(F):5'- TTAGCTGTCACTGTCCGCAGAAG -3'
(R):5'- GGCATTTCACACAGGTGTAAG -3'
Posted On2018-05-21