Incidental Mutation 'R6479:Trim37'
ID516990
Institutional Source Beutler Lab
Gene Symbol Trim37
Ensembl Gene ENSMUSG00000018548
Gene Nametripartite motif-containing 37
SynonymsMUL, 1110032A10Rik, 2810004E07Rik, TEF3
MMRRC Submission
Accession Numbers

Genbank: NM_197987

Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R6479 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location87127077-87220683 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 87216487 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 317 (E317*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041282]
Predicted Effect probably null
Transcript: ENSMUST00000041282
AA Change: E915*
SMART Domains Protein: ENSMUSP00000049057
Gene: ENSMUSG00000018548
AA Change: E915*

DomainStartEndE-ValueType
RING 15 54 1.71e-1 SMART
BBOX 90 132 7.32e-12 SMART
BBC 132 254 3.05e-31 SMART
MATH 281 384 1.51e-13 SMART
low complexity region 494 504 N/A INTRINSIC
low complexity region 516 529 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
low complexity region 579 588 N/A INTRINSIC
low complexity region 612 626 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000154138
AA Change: E317*
SMART Domains Protein: ENSMUSP00000118260
Gene: ENSMUSG00000018548
AA Change: E317*

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 56 70 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
Meta Mutation Damage Score 0.642 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.0%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which is typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. In mouse this protein is proposed to oligomerize through its coiled coil domain and has been reported to be expressed in neural crest-derived tissues as well as in tissues whose development is regulated by mesenchymal-epithelial interactions. In humans, mutations in this gene are associated with mulibrey (muscle-liver-brain-eye) nanism, an autosomal recessive disorder characterized by prenatal onset growth failure, cardiomyopathy and dysmorphic features. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are infertile due to gonadal degeneration and exhibit late-onset weight loss, smaller skull size, non-compaction cardiomyopathy, hepatomegaly, fatty liver, altered glucose metabolism, splenomegaly, and increased tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Gene trapped(7)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A C 8: 24,629,665 S533A probably benign Het
Akap6 T G 12: 53,141,169 S1789A probably damaging Het
Alox15 A G 11: 70,345,185 S519P probably damaging Het
Anapc2 A G 2: 25,285,395 K816E probably benign Het
Atp6v1a T C 16: 44,098,758 D488G probably benign Het
Banp A G 8: 121,991,437 probably null Het
Camsap1 A G 2: 25,935,862 C1367R possibly damaging Het
Casz1 C A 4: 148,937,078 H539Q probably damaging Het
Ccl5 A G 11: 83,530,386 Y26H probably benign Het
Cops3 A T 11: 59,833,072 S86R probably benign Het
Cts7 A G 13: 61,355,641 S170P probably benign Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Dennd1b C T 1: 139,041,960 probably benign Het
Dicer1 T C 12: 104,696,723 D1533G probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock4 A G 12: 40,828,955 E1531G probably damaging Het
Erap1 A G 13: 74,663,493 probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gm10309 A T 17: 86,504,579 M1K probably null Het
Gm21994 C T 2: 150,254,591 G306D probably damaging Het
Gm4450 T A 3: 98,446,841 E114V possibly damaging Het
Gm4884 A T 7: 41,040,787 N36Y probably damaging Het
Hmcn1 G A 1: 150,677,302 R2546* probably null Het
Hmcn2 A G 2: 31,425,468 D3743G probably damaging Het
Irak2 A T 6: 113,686,941 N423Y probably damaging Het
Jarid2 G A 13: 44,848,289 G26D probably benign Het
Kif13b A G 14: 64,751,525 K785R probably benign Het
Lamc3 A T 2: 31,887,401 I20F probably benign Het
Limk1 G A 5: 134,661,519 probably benign Het
Lrp4 C T 2: 91,487,084 T851I probably damaging Het
Med13 G A 11: 86,357,527 probably benign Het
Megf10 T C 18: 57,246,570 F273L possibly damaging Het
Meltf T A 16: 31,881,882 D73E probably damaging Het
Mroh7 A G 4: 106,703,188 F640L possibly damaging Het
Mtor T C 4: 148,551,000 S2448P probably benign Het
Myo3a T C 2: 22,577,865 V377A probably benign Het
Myo5b T C 18: 74,617,015 V183A probably damaging Het
Nedd4l G A 18: 65,209,681 R755H probably damaging Het
Nrde2 T C 12: 100,143,948 T275A probably benign Het
Olfr658 A G 7: 104,645,126 I80T probably benign Het
Osgepl1 T C 1: 53,321,543 V381A probably benign Het
Pcdha1 C T 18: 36,931,456 T391I probably benign Het
Pdp1 T C 4: 11,961,327 N328S probably damaging Het
Pepd A G 7: 35,040,722 E340G probably benign Het
Plch1 T C 3: 63,744,510 T387A probably benign Het
Plxnb1 C A 9: 109,111,665 T1536K possibly damaging Het
Rbp7 T C 4: 149,449,890 T130A probably benign Het
Rhot2 A T 17: 25,841,080 V309E probably benign Het
Slc37a1 A G 17: 31,338,990 I421M possibly damaging Het
Slit2 T A 5: 48,231,989 L585H probably damaging Het
Spint4 C A 2: 164,700,844 A119D probably benign Het
Strip2 G T 6: 29,944,497 probably null Het
Stxbp4 T C 11: 90,619,187 Y59C probably damaging Het
Syne1 G A 10: 5,231,679 Q4219* probably null Het
Syne1 A T 10: 5,456,826 I37N probably damaging Het
Syne4 G T 7: 30,316,915 G179* probably null Het
Tead1 T C 7: 112,861,465 V192A probably benign Het
Wdfy3 A C 5: 101,913,179 Y1390D probably damaging Het
Wdr81 A G 11: 75,452,105 F779L possibly damaging Het
Other mutations in Trim37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Trim37 APN 11 87186393 missense probably damaging 1.00
IGL01372:Trim37 APN 11 87184946 missense probably benign 0.00
IGL01510:Trim37 APN 11 87177860 missense probably damaging 1.00
IGL02055:Trim37 APN 11 87166649 missense probably benign 0.44
IGL02106:Trim37 APN 11 87201404 nonsense probably null
IGL02251:Trim37 APN 11 87167430 splice site probably benign
IGL02498:Trim37 APN 11 87185050 missense probably benign
IGL02836:Trim37 APN 11 87196959 missense probably benign 0.01
IGL03089:Trim37 APN 11 87190137 missense probably damaging 1.00
IGL03302:Trim37 APN 11 87147001 missense possibly damaging 0.89
IGL03347:Trim37 APN 11 87201621 missense possibly damaging 0.80
G5030:Trim37 UTSW 11 87143141 missense probably damaging 0.96
R0396:Trim37 UTSW 11 87146968 missense probably damaging 1.00
R0544:Trim37 UTSW 11 87145502 nonsense probably null
R0946:Trim37 UTSW 11 87146955 missense probably damaging 0.99
R1481:Trim37 UTSW 11 87129759 nonsense probably null
R1799:Trim37 UTSW 11 87178019 missense probably damaging 1.00
R1851:Trim37 UTSW 11 87218306 missense probably damaging 1.00
R2107:Trim37 UTSW 11 87159825 missense probably benign 0.04
R3878:Trim37 UTSW 11 87206002 missense probably benign 0.10
R4049:Trim37 UTSW 11 87140603 critical splice donor site probably null
R4224:Trim37 UTSW 11 87216463 missense probably damaging 1.00
R4486:Trim37 UTSW 11 87196825 missense probably benign 0.31
R5244:Trim37 UTSW 11 87218257 missense probably benign 0.10
R5343:Trim37 UTSW 11 87137603 missense probably damaging 0.98
R5417:Trim37 UTSW 11 87166679 missense probably damaging 1.00
R5894:Trim37 UTSW 11 87201440 missense probably damaging 0.99
R5911:Trim37 UTSW 11 87196837 nonsense probably null
R5957:Trim37 UTSW 11 87145551 missense probably damaging 1.00
R6159:Trim37 UTSW 11 87216548 critical splice donor site probably null
R6527:Trim37 UTSW 11 87190084 missense probably damaging 1.00
R7021:Trim37 UTSW 11 87167509 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGCCCAGTTCTAATTAAAGAGCAC -3'
(R):5'- GCCACGTTGTCTACCACAGAATG -3'

Sequencing Primer
(F):5'- CATCCGTGGATTCTCATC -3'
(R):5'- GAATGGTCCCTCACAAATAACAG -3'
Posted On2018-05-21