Incidental Mutation 'R6479:Erap1'
ID516998
Institutional Source Beutler Lab
Gene Symbol Erap1
Ensembl Gene ENSMUSG00000021583
Gene Nameendoplasmic reticulum aminopeptidase 1
SynonymsERAAP, Arts1, PILSAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R6479 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location74639568-74693201 bp(+) (GRCm38)
Type of Mutationunclassified (1132 bp from exon)
DNA Base Change (assembly) A to G at 74663493 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169114] [ENSMUST00000221822] [ENSMUST00000222127]
Predicted Effect possibly damaging
Transcript: ENSMUST00000169114
AA Change: D324G

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133166
Gene: ENSMUSG00000021583
AA Change: D324G

DomainStartEndE-ValueType
Pfam:Peptidase_M1 42 430 2.7e-135 PFAM
low complexity region 488 501 N/A INTRINSIC
Pfam:ERAP1_C 586 904 1.7e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221606
Predicted Effect probably null
Transcript: ENSMUST00000221822
Predicted Effect probably benign
Transcript: ENSMUST00000222127
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.0%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an aminopeptidase involved in trimming HLA class I-binding precursors so that they can be presented on MHC class I molecules. The encoded protein acts as a monomer or as a heterodimer with ERAP2. This protein may also be involved in blood pressure regulation by inactivation of angiotensin II. Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a targeted mutation may exhibit extramedullary hematopoiesis of the spleen, thymus hyperplasia, or enlarged kidneys at older ages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A C 8: 24,629,665 S533A probably benign Het
Akap6 T G 12: 53,141,169 S1789A probably damaging Het
Alox15 A G 11: 70,345,185 S519P probably damaging Het
Anapc2 A G 2: 25,285,395 K816E probably benign Het
Atp6v1a T C 16: 44,098,758 D488G probably benign Het
Banp A G 8: 121,991,437 probably null Het
Camsap1 A G 2: 25,935,862 C1367R possibly damaging Het
Casz1 C A 4: 148,937,078 H539Q probably damaging Het
Ccl5 A G 11: 83,530,386 Y26H probably benign Het
Cops3 A T 11: 59,833,072 S86R probably benign Het
Cts7 A G 13: 61,355,641 S170P probably benign Het
Cxcl15 A T 5: 90,795,245 E35D possibly damaging Het
Dennd1b C T 1: 139,041,960 probably benign Het
Dicer1 T C 12: 104,696,723 D1533G probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock4 A G 12: 40,828,955 E1531G probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gm10309 A T 17: 86,504,579 M1K probably null Het
Gm21994 C T 2: 150,254,591 G306D probably damaging Het
Gm4450 T A 3: 98,446,841 E114V possibly damaging Het
Gm4884 A T 7: 41,040,787 N36Y probably damaging Het
Hmcn1 G A 1: 150,677,302 R2546* probably null Het
Hmcn2 A G 2: 31,425,468 D3743G probably damaging Het
Irak2 A T 6: 113,686,941 N423Y probably damaging Het
Jarid2 G A 13: 44,848,289 G26D probably benign Het
Kif13b A G 14: 64,751,525 K785R probably benign Het
Lamc3 A T 2: 31,887,401 I20F probably benign Het
Limk1 G A 5: 134,661,519 probably benign Het
Lrp4 C T 2: 91,487,084 T851I probably damaging Het
Med13 G A 11: 86,357,527 probably benign Het
Megf10 T C 18: 57,246,570 F273L possibly damaging Het
Meltf T A 16: 31,881,882 D73E probably damaging Het
Mroh7 A G 4: 106,703,188 F640L possibly damaging Het
Mtor T C 4: 148,551,000 S2448P probably benign Het
Myo3a T C 2: 22,577,865 V377A probably benign Het
Myo5b T C 18: 74,617,015 V183A probably damaging Het
Nedd4l G A 18: 65,209,681 R755H probably damaging Het
Nrde2 T C 12: 100,143,948 T275A probably benign Het
Olfr658 A G 7: 104,645,126 I80T probably benign Het
Osgepl1 T C 1: 53,321,543 V381A probably benign Het
Pcdha1 C T 18: 36,931,456 T391I probably benign Het
Pdp1 T C 4: 11,961,327 N328S probably damaging Het
Pepd A G 7: 35,040,722 E340G probably benign Het
Plch1 T C 3: 63,744,510 T387A probably benign Het
Plxnb1 C A 9: 109,111,665 T1536K possibly damaging Het
Rbp7 T C 4: 149,449,890 T130A probably benign Het
Rhot2 A T 17: 25,841,080 V309E probably benign Het
Slc37a1 A G 17: 31,338,990 I421M possibly damaging Het
Slit2 T A 5: 48,231,989 L585H probably damaging Het
Spint4 C A 2: 164,700,844 A119D probably benign Het
Strip2 G T 6: 29,944,497 probably null Het
Stxbp4 T C 11: 90,619,187 Y59C probably damaging Het
Syne1 G A 10: 5,231,679 Q4219* probably null Het
Syne1 A T 10: 5,456,826 I37N probably damaging Het
Syne4 G T 7: 30,316,915 G179* probably null Het
Tead1 T C 7: 112,861,465 V192A probably benign Het
Trim37 G T 11: 87,216,487 E317* probably null Het
Wdfy3 A C 5: 101,913,179 Y1390D probably damaging Het
Wdr81 A G 11: 75,452,105 F779L possibly damaging Het
Other mutations in Erap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Erap1 APN 13 74673659 missense probably benign 0.17
IGL00661:Erap1 APN 13 74674789 unclassified probably benign
IGL00903:Erap1 APN 13 74673707 missense probably benign
IGL01095:Erap1 APN 13 74668094 missense probably benign 0.04
IGL01536:Erap1 APN 13 74662423 nonsense probably null
IGL01646:Erap1 APN 13 74666172 missense probably damaging 1.00
IGL01674:Erap1 APN 13 74664231 unclassified probably benign
IGL01795:Erap1 APN 13 74666090 unclassified probably null
IGL01922:Erap1 APN 13 74662387 missense probably damaging 1.00
IGL01951:Erap1 APN 13 74675295 missense probably damaging 0.99
IGL02106:Erap1 APN 13 74646639 missense probably benign
IGL02369:Erap1 APN 13 74666526 missense probably benign 0.05
IGL02669:Erap1 APN 13 74675868 missense probably benign 0.13
IGL02866:Erap1 APN 13 74667999 missense probably damaging 0.96
IGL03093:Erap1 APN 13 74675280 missense probably benign 0.10
IGL03265:Erap1 APN 13 74664127 missense probably damaging 1.00
R0091:Erap1 UTSW 13 74668052 missense possibly damaging 0.88
R0456:Erap1 UTSW 13 74664220 missense probably benign 0.24
R0556:Erap1 UTSW 13 74660325 missense probably damaging 1.00
R0627:Erap1 UTSW 13 74675814 unclassified probably benign
R0825:Erap1 UTSW 13 74674614 unclassified probably benign
R1123:Erap1 UTSW 13 74673643 missense probably benign
R1530:Erap1 UTSW 13 74646543 missense probably benign 0.06
R1619:Erap1 UTSW 13 74671381 missense probably damaging 1.00
R1731:Erap1 UTSW 13 74666122 nonsense probably null
R1944:Erap1 UTSW 13 74646639 missense probably benign
R2016:Erap1 UTSW 13 74664151 missense probably damaging 1.00
R2022:Erap1 UTSW 13 74666508 missense probably benign 0.08
R2023:Erap1 UTSW 13 74666508 missense probably benign 0.08
R2045:Erap1 UTSW 13 74669450 missense probably benign 0.01
R2081:Erap1 UTSW 13 74675307 missense possibly damaging 0.67
R2187:Erap1 UTSW 13 74662405 missense probably damaging 0.98
R2198:Erap1 UTSW 13 74646687 missense probably damaging 0.97
R3938:Erap1 UTSW 13 74668028 missense probably damaging 1.00
R4052:Erap1 UTSW 13 74675340 missense probably benign 0.13
R4062:Erap1 UTSW 13 74663536 missense probably benign 0.02
R4128:Erap1 UTSW 13 74666196 missense probably damaging 1.00
R4247:Erap1 UTSW 13 74675295 missense probably damaging 0.99
R4562:Erap1 UTSW 13 74673659 missense probably benign 0.21
R4691:Erap1 UTSW 13 74673692 missense probably damaging 0.99
R4831:Erap1 UTSW 13 74690647 missense probably damaging 1.00
R4916:Erap1 UTSW 13 74646528 missense probably benign
R4983:Erap1 UTSW 13 74690710 missense probably benign 0.01
R5213:Erap1 UTSW 13 74671495 splice site probably null
R5229:Erap1 UTSW 13 74660375 missense possibly damaging 0.94
R5367:Erap1 UTSW 13 74646561 missense probably damaging 0.99
R5463:Erap1 UTSW 13 74646414 missense probably damaging 1.00
R5566:Erap1 UTSW 13 74662412 missense probably damaging 1.00
R5972:Erap1 UTSW 13 74662304 splice site probably null
R6112:Erap1 UTSW 13 74646279 missense probably benign 0.44
R6132:Erap1 UTSW 13 74660282 missense probably benign 0.00
R6180:Erap1 UTSW 13 74666226 missense possibly damaging 0.55
R6314:Erap1 UTSW 13 74674775 missense probably damaging 0.99
R6919:Erap1 UTSW 13 74671433 missense probably benign 0.20
R7199:Erap1 UTSW 13 74666139 missense probably benign 0.10
X0067:Erap1 UTSW 13 74660372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCATTCAAGGGCTTAGG -3'
(R):5'- GCAGACTACCTATTCTCCAGC -3'

Sequencing Primer
(F):5'- CATTCAAGGGCTTAGGTTTTCAC -3'
(R):5'- TACCTATTCTCCAGCAAAGGATTC -3'
Posted On2018-05-21