Incidental Mutation 'R6480:Lct'
ID517011
Institutional Source Beutler Lab
Gene Symbol Lct
Ensembl Gene ENSMUSG00000026354
Gene Namelactase
SynonymsLPH, LOC226413, Lphl
MMRRC Submission
Accession Numbers

Genbank: NM_001081078; MGI:104576

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6480 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location128284756-128328318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128294320 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1494 (T1494I)
Ref Sequence ENSEMBL: ENSMUSP00000073190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073490]
Predicted Effect probably damaging
Transcript: ENSMUST00000073490
AA Change: T1494I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: T1494I

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 76 226 1.6e-19 PFAM
low complexity region 322 340 N/A INTRINSIC
Pfam:Glyco_hydro_1 380 849 4.8e-169 PFAM
low complexity region 865 875 N/A INTRINSIC
Pfam:Glyco_hydro_1 902 1368 3.7e-181 PFAM
Pfam:Glyco_hydro_1 1377 1844 6.9e-183 PFAM
transmembrane domain 1885 1907 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162067
Meta Mutation Damage Score 0.476 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl8b T A 6: 108,815,049 N90K possibly damaging Het
Art3 T C 5: 92,392,817 F140L probably damaging Het
Ascc3 T A 10: 50,710,953 M967K probably damaging Het
Ccne1 G A 7: 38,106,854 probably benign Het
Cdc14b T C 13: 64,225,650 probably null Het
Ceacam2 T A 7: 25,519,989 E282V probably damaging Het
Clk4 T A 11: 51,270,546 C86* probably null Het
Cul2 A C 18: 3,417,561 K115T possibly damaging Het
Dhx29 A T 13: 112,953,788 K800* probably null Het
Dlec1 T C 9: 119,147,690 F1741S probably benign Het
Dnah12 A G 14: 26,872,455 T3455A probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd4 A T 7: 141,294,793 I366F possibly damaging Het
Fam169b T A 7: 68,353,718 Y273* probably null Het
Fbn1 T A 2: 125,335,418 Y1833F probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gjb6 T C 14: 57,124,442 I121V probably benign Het
Glg1 T C 8: 111,197,706 T217A possibly damaging Het
Igkv5-48 A G 6: 69,726,826 S32P probably benign Het
Itgax C A 7: 128,148,599 F1062L probably benign Het
Lilra6 G A 7: 3,912,933 T309I probably damaging Het
Mical3 T C 6: 121,034,275 T321A possibly damaging Het
Mmp23 T A 4: 155,652,341 N104I probably damaging Het
Muc3 T C 5: 137,142,390 Y131C probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ndufs2 A G 1: 171,236,698 S348P probably damaging Het
Nepro T C 16: 44,727,075 S52P probably damaging Het
Nlrp6 A G 7: 140,927,443 E874G possibly damaging Het
Nsmce1 A G 7: 125,491,418 V9A probably benign Het
Olfr13 T C 6: 43,174,066 F27L probably benign Het
Olfr1458 T A 19: 13,102,474 T277S probably benign Het
Olfr357 T C 2: 36,996,995 F62L probably benign Het
Olfr788 A T 10: 129,472,721 I10F possibly damaging Het
Per2 A T 1: 91,429,382 probably null Het
Pgbd1 T C 13: 21,423,476 I183V probably benign Het
Pik3c2g T C 6: 139,730,469 V113A probably benign Het
Pipox A G 11: 77,882,648 L259P probably damaging Het
Pkd1l3 C T 8: 109,638,387 Q1124* probably null Het
Plcd3 A G 11: 103,074,931 S492P possibly damaging Het
Rcor2 T G 19: 7,271,046 M142R probably benign Het
Rwdd3 T C 3: 121,156,452 E115G probably damaging Het
Slc13a3 T C 2: 165,408,898 Y475C probably damaging Het
Slc14a2 A T 18: 78,159,082 I611N possibly damaging Het
Slc25a24 G T 3: 109,136,301 M91I probably damaging Het
Spg11 T C 2: 122,092,305 S888G probably benign Het
Spta1 A T 1: 174,187,148 probably null Het
Stk35 C A 2: 129,810,687 D369E possibly damaging Het
Tanc1 T C 2: 59,807,642 S889P probably damaging Het
Tbc1d10b T C 7: 127,198,878 N697S probably damaging Het
Tcof1 A T 18: 60,814,780 probably null Het
Tg T A 15: 66,671,311 Y25N probably damaging Het
Thbs1 T C 2: 118,119,117 C563R probably damaging Het
Tlr11 A G 14: 50,363,055 S833G possibly damaging Het
Uggt2 T A 14: 119,057,564 H550L probably benign Het
Utp20 A G 10: 88,755,186 probably null Het
Wbp1l T A 19: 46,654,319 L253Q probably damaging Het
Zfp433 T A 10: 81,720,244 S161R possibly damaging Het
Zfp865 A G 7: 5,029,783 T256A probably damaging Het
Zpr1 A G 9: 46,274,711 D160G probably benign Het
Other mutations in Lct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Lct APN 1 128287556 missense probably benign 0.09
IGL00970:Lct APN 1 128304068 missense probably damaging 1.00
IGL01022:Lct APN 1 128300859 missense probably benign
IGL01878:Lct APN 1 128294266 missense probably damaging 1.00
IGL01892:Lct APN 1 128307605 missense probably damaging 1.00
IGL02307:Lct APN 1 128286590 missense possibly damaging 0.70
IGL02434:Lct APN 1 128303790 missense probably damaging 0.97
IGL02559:Lct APN 1 128294266 missense probably damaging 1.00
IGL02623:Lct APN 1 128308251 missense probably benign 0.01
IGL02818:Lct APN 1 128300168 missense probably damaging 1.00
IGL02949:Lct APN 1 128313132 missense probably benign 0.26
IGL02951:Lct APN 1 128300211 missense probably damaging 1.00
IGL03087:Lct APN 1 128300375 missense possibly damaging 0.81
IGL03227:Lct APN 1 128327689 missense probably benign 0.09
ANU18:Lct UTSW 1 128308047 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0135:Lct UTSW 1 128285123 missense probably damaging 0.98
R0145:Lct UTSW 1 128327895 missense probably benign 0.00
R0179:Lct UTSW 1 128327685 missense probably benign
R0331:Lct UTSW 1 128298742 splice site probably benign
R0366:Lct UTSW 1 128286462 missense probably benign 0.03
R0399:Lct UTSW 1 128300525 missense probably damaging 1.00
R0492:Lct UTSW 1 128300582 missense probably damaging 1.00
R0548:Lct UTSW 1 128285195 missense probably damaging 1.00
R0691:Lct UTSW 1 128308234 missense probably benign 0.00
R0755:Lct UTSW 1 128294135 missense possibly damaging 0.46
R0839:Lct UTSW 1 128286609 missense probably benign 0.00
R1128:Lct UTSW 1 128301309 missense probably damaging 0.99
R1135:Lct UTSW 1 128294124 critical splice donor site probably null
R1321:Lct UTSW 1 128300022 missense probably benign
R1448:Lct UTSW 1 128307822 missense probably damaging 0.99
R1450:Lct UTSW 1 128307903 missense probably damaging 1.00
R1572:Lct UTSW 1 128294195 missense probably benign 0.25
R1582:Lct UTSW 1 128300562 missense probably damaging 1.00
R1668:Lct UTSW 1 128287722 splice site probably null
R1757:Lct UTSW 1 128301257 missense probably damaging 1.00
R1775:Lct UTSW 1 128300301 missense probably damaging 1.00
R1792:Lct UTSW 1 128327942 missense possibly damaging 0.54
R1815:Lct UTSW 1 128300159 missense probably damaging 1.00
R1932:Lct UTSW 1 128294161 missense probably damaging 1.00
R2325:Lct UTSW 1 128304226 missense probably damaging 1.00
R2381:Lct UTSW 1 128304121 nonsense probably null
R3001:Lct UTSW 1 128304226 missense probably damaging 1.00
R3002:Lct UTSW 1 128304226 missense probably damaging 1.00
R3003:Lct UTSW 1 128304226 missense probably damaging 1.00
R3011:Lct UTSW 1 128301372 missense possibly damaging 0.74
R3082:Lct UTSW 1 128287608 missense probably damaging 1.00
R3683:Lct UTSW 1 128304226 missense probably damaging 1.00
R3684:Lct UTSW 1 128304226 missense probably damaging 1.00
R3726:Lct UTSW 1 128304226 missense probably damaging 1.00
R3886:Lct UTSW 1 128304226 missense probably damaging 1.00
R3887:Lct UTSW 1 128304226 missense probably damaging 1.00
R3888:Lct UTSW 1 128304226 missense probably damaging 1.00
R4019:Lct UTSW 1 128304226 missense probably damaging 1.00
R4027:Lct UTSW 1 128285181 missense probably benign 0.00
R4226:Lct UTSW 1 128304226 missense probably damaging 1.00
R4409:Lct UTSW 1 128304226 missense probably damaging 1.00
R4514:Lct UTSW 1 128300514 missense probably benign
R4570:Lct UTSW 1 128299904 missense probably benign 0.01
R4776:Lct UTSW 1 128300387 missense probably damaging 0.99
R5001:Lct UTSW 1 128308241 missense probably damaging 0.96
R5021:Lct UTSW 1 128300565 missense probably benign 0.38
R5318:Lct UTSW 1 128304372 missense probably damaging 1.00
R5330:Lct UTSW 1 128298529 missense probably benign 0.06
R5385:Lct UTSW 1 128311617 missense possibly damaging 0.63
R5499:Lct UTSW 1 128286677 missense probably damaging 1.00
R5508:Lct UTSW 1 128294131 missense probably damaging 1.00
R5642:Lct UTSW 1 128295232 missense probably damaging 1.00
R5724:Lct UTSW 1 128300336 missense probably benign
R6026:Lct UTSW 1 128300018 missense probably benign
R6044:Lct UTSW 1 128307980 missense possibly damaging 0.95
R6175:Lct UTSW 1 128327714 missense probably damaging 1.00
R6277:Lct UTSW 1 128304237 missense probably benign 0.01
R6412:Lct UTSW 1 128327718 missense probably benign 0.00
R6526:Lct UTSW 1 128300478 missense probably benign 0.05
R6620:Lct UTSW 1 128295072 critical splice donor site probably null
R7214:Lct UTSW 1 128300460 missense probably benign 0.00
R7308:Lct UTSW 1 128319087 missense probably benign 0.00
X0052:Lct UTSW 1 128307630 missense probably damaging 1.00
YA93:Lct UTSW 1 128301320 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTATGACCCAAGGAGCTGAC -3'
(R):5'- GAGATGTCCATAAATTCACATGGTACC -3'

Sequencing Primer
(F):5'- CAAGTTGGACGAGGGCCTTTAC -3'
(R):5'- TGGTACCAAATTAAAGGATGAAACC -3'
Posted On2018-05-21