Incidental Mutation 'R6480:Rwdd3'
ID517022
Institutional Source Beutler Lab
Gene Symbol Rwdd3
Ensembl Gene ENSMUSG00000028133
Gene NameRWD domain containing 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6480 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location121155398-121171695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121156452 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 115 (E115G)
Ref Sequence ENSEMBL: ENSMUSP00000133036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039761] [ENSMUST00000106466] [ENSMUST00000106467] [ENSMUST00000164925] [ENSMUST00000170781]
Predicted Effect probably damaging
Transcript: ENSMUST00000039761
AA Change: E213G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040826
Gene: ENSMUSG00000028133
AA Change: E213G

DomainStartEndE-ValueType
RWD 7 114 3.63e-10 SMART
Pfam:DUF1115 144 262 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106465
Predicted Effect probably damaging
Transcript: ENSMUST00000106466
AA Change: E213G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102074
Gene: ENSMUSG00000028133
AA Change: E213G

DomainStartEndE-ValueType
RWD 7 114 3.63e-10 SMART
Pfam:DUF1115 144 262 1.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106467
AA Change: E285G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102075
Gene: ENSMUSG00000028133
AA Change: E285G

DomainStartEndE-ValueType
RWD 7 186 1.52e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000164573
AA Change: E39G
SMART Domains Protein: ENSMUSP00000130734
Gene: ENSMUSG00000028133
AA Change: E39G

DomainStartEndE-ValueType
Blast:RWD 2 36 1e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000164925
AA Change: E115G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133036
Gene: ENSMUSG00000028133
AA Change: E115G

DomainStartEndE-ValueType
PDB:2EBK|A 1 23 2e-6 PDB
Blast:RWD 26 111 6e-42 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164968
Predicted Effect silent
Transcript: ENSMUST00000170781
SMART Domains Protein: ENSMUSP00000129262
Gene: ENSMUSG00000028133

DomainStartEndE-ValueType
RWD 7 114 3.63e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl8b T A 6: 108,815,049 N90K possibly damaging Het
Art3 T C 5: 92,392,817 F140L probably damaging Het
Ascc3 T A 10: 50,710,953 M967K probably damaging Het
Ccne1 G A 7: 38,106,854 probably benign Het
Cdc14b T C 13: 64,225,650 probably null Het
Ceacam2 T A 7: 25,519,989 E282V probably damaging Het
Clk4 T A 11: 51,270,546 C86* probably null Het
Cul2 A C 18: 3,417,561 K115T possibly damaging Het
Dhx29 A T 13: 112,953,788 K800* probably null Het
Dlec1 T C 9: 119,147,690 F1741S probably benign Het
Dnah12 A G 14: 26,872,455 T3455A probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd4 A T 7: 141,294,793 I366F possibly damaging Het
Fam169b T A 7: 68,353,718 Y273* probably null Het
Fbn1 T A 2: 125,335,418 Y1833F probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gjb6 T C 14: 57,124,442 I121V probably benign Het
Glg1 T C 8: 111,197,706 T217A possibly damaging Het
Igkv5-48 A G 6: 69,726,826 S32P probably benign Het
Itgax C A 7: 128,148,599 F1062L probably benign Het
Lct G A 1: 128,294,320 T1494I probably damaging Het
Lilra6 G A 7: 3,912,933 T309I probably damaging Het
Mical3 T C 6: 121,034,275 T321A possibly damaging Het
Mmp23 T A 4: 155,652,341 N104I probably damaging Het
Muc3 T C 5: 137,142,390 Y131C probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ndufs2 A G 1: 171,236,698 S348P probably damaging Het
Nepro T C 16: 44,727,075 S52P probably damaging Het
Nlrp6 A G 7: 140,927,443 E874G possibly damaging Het
Nsmce1 A G 7: 125,491,418 V9A probably benign Het
Olfr13 T C 6: 43,174,066 F27L probably benign Het
Olfr1458 T A 19: 13,102,474 T277S probably benign Het
Olfr357 T C 2: 36,996,995 F62L probably benign Het
Olfr788 A T 10: 129,472,721 I10F possibly damaging Het
Per2 A T 1: 91,429,382 probably null Het
Pgbd1 T C 13: 21,423,476 I183V probably benign Het
Pik3c2g T C 6: 139,730,469 V113A probably benign Het
Pipox A G 11: 77,882,648 L259P probably damaging Het
Pkd1l3 C T 8: 109,638,387 Q1124* probably null Het
Plcd3 A G 11: 103,074,931 S492P possibly damaging Het
Rcor2 T G 19: 7,271,046 M142R probably benign Het
Slc13a3 T C 2: 165,408,898 Y475C probably damaging Het
Slc14a2 A T 18: 78,159,082 I611N possibly damaging Het
Slc25a24 G T 3: 109,136,301 M91I probably damaging Het
Spg11 T C 2: 122,092,305 S888G probably benign Het
Spta1 A T 1: 174,187,148 probably null Het
Stk35 C A 2: 129,810,687 D369E possibly damaging Het
Tanc1 T C 2: 59,807,642 S889P probably damaging Het
Tbc1d10b T C 7: 127,198,878 N697S probably damaging Het
Tcof1 A T 18: 60,814,780 probably null Het
Tg T A 15: 66,671,311 Y25N probably damaging Het
Thbs1 T C 2: 118,119,117 C563R probably damaging Het
Tlr11 A G 14: 50,363,055 S833G possibly damaging Het
Uggt2 T A 14: 119,057,564 H550L probably benign Het
Utp20 A G 10: 88,755,186 probably null Het
Wbp1l T A 19: 46,654,319 L253Q probably damaging Het
Zfp433 T A 10: 81,720,244 S161R possibly damaging Het
Zfp865 A G 7: 5,029,783 T256A probably damaging Het
Zpr1 A G 9: 46,274,711 D160G probably benign Het
Other mutations in Rwdd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Rwdd3 APN 3 121171633 missense possibly damaging 0.79
IGL02367:Rwdd3 APN 3 121159030 missense probably damaging 0.99
R0466:Rwdd3 UTSW 3 121159019 missense possibly damaging 0.82
R0733:Rwdd3 UTSW 3 121171607 missense probably benign
R4270:Rwdd3 UTSW 3 121158901 missense probably damaging 1.00
R4384:Rwdd3 UTSW 3 121158757 intron probably benign
R4650:Rwdd3 UTSW 3 121159177 missense probably damaging 1.00
R4960:Rwdd3 UTSW 3 121158821 missense probably damaging 1.00
R5061:Rwdd3 UTSW 3 121159783 intron probably benign
R6000:Rwdd3 UTSW 3 121156513 missense probably damaging 1.00
R7117:Rwdd3 UTSW 3 121171338 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AACTCCTCCAGTGTTGAATACTC -3'
(R):5'- TCTGCCACCTATGTAAAGGCAC -3'

Sequencing Primer
(F):5'- GAATACTCTTTGACTTCAAACGCCAG -3'
(R):5'- TGTAAAGGCACTGTGTAACTCCC -3'
Posted On2018-05-21