Incidental Mutation 'R6480:Utp20'
ID517047
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R6480 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 88755186 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
Predicted Effect probably null
Transcript: ENSMUST00000004470
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl8b T A 6: 108,815,049 N90K possibly damaging Het
Art3 T C 5: 92,392,817 F140L probably damaging Het
Ascc3 T A 10: 50,710,953 M967K probably damaging Het
Ccne1 G A 7: 38,106,854 probably benign Het
Cdc14b T C 13: 64,225,650 probably null Het
Ceacam2 T A 7: 25,519,989 E282V probably damaging Het
Clk4 T A 11: 51,270,546 C86* probably null Het
Cul2 A C 18: 3,417,561 K115T possibly damaging Het
Dhx29 A T 13: 112,953,788 K800* probably null Het
Dlec1 T C 9: 119,147,690 F1741S probably benign Het
Dnah12 A G 14: 26,872,455 T3455A probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd4 A T 7: 141,294,793 I366F possibly damaging Het
Fam169b T A 7: 68,353,718 Y273* probably null Het
Fbn1 T A 2: 125,335,418 Y1833F probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gjb6 T C 14: 57,124,442 I121V probably benign Het
Glg1 T C 8: 111,197,706 T217A possibly damaging Het
Igkv5-48 A G 6: 69,726,826 S32P probably benign Het
Itgax C A 7: 128,148,599 F1062L probably benign Het
Lct G A 1: 128,294,320 T1494I probably damaging Het
Lilra6 G A 7: 3,912,933 T309I probably damaging Het
Mical3 T C 6: 121,034,275 T321A possibly damaging Het
Mmp23 T A 4: 155,652,341 N104I probably damaging Het
Muc3 T C 5: 137,142,390 Y131C probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ndufs2 A G 1: 171,236,698 S348P probably damaging Het
Nepro T C 16: 44,727,075 S52P probably damaging Het
Nlrp6 A G 7: 140,927,443 E874G possibly damaging Het
Nsmce1 A G 7: 125,491,418 V9A probably benign Het
Olfr13 T C 6: 43,174,066 F27L probably benign Het
Olfr1458 T A 19: 13,102,474 T277S probably benign Het
Olfr357 T C 2: 36,996,995 F62L probably benign Het
Olfr788 A T 10: 129,472,721 I10F possibly damaging Het
Per2 A T 1: 91,429,382 probably null Het
Pgbd1 T C 13: 21,423,476 I183V probably benign Het
Pik3c2g T C 6: 139,730,469 V113A probably benign Het
Pipox A G 11: 77,882,648 L259P probably damaging Het
Pkd1l3 C T 8: 109,638,387 Q1124* probably null Het
Plcd3 A G 11: 103,074,931 S492P possibly damaging Het
Rcor2 T G 19: 7,271,046 M142R probably benign Het
Rwdd3 T C 3: 121,156,452 E115G probably damaging Het
Slc13a3 T C 2: 165,408,898 Y475C probably damaging Het
Slc14a2 A T 18: 78,159,082 I611N possibly damaging Het
Slc25a24 G T 3: 109,136,301 M91I probably damaging Het
Spg11 T C 2: 122,092,305 S888G probably benign Het
Spta1 A T 1: 174,187,148 probably null Het
Stk35 C A 2: 129,810,687 D369E possibly damaging Het
Tanc1 T C 2: 59,807,642 S889P probably damaging Het
Tbc1d10b T C 7: 127,198,878 N697S probably damaging Het
Tcof1 A T 18: 60,814,780 probably null Het
Tg T A 15: 66,671,311 Y25N probably damaging Het
Thbs1 T C 2: 118,119,117 C563R probably damaging Het
Tlr11 A G 14: 50,363,055 S833G possibly damaging Het
Uggt2 T A 14: 119,057,564 H550L probably benign Het
Wbp1l T A 19: 46,654,319 L253Q probably damaging Het
Zfp433 T A 10: 81,720,244 S161R possibly damaging Het
Zfp865 A G 7: 5,029,783 T256A probably damaging Het
Zpr1 A G 9: 46,274,711 D160G probably benign Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAGAGTGAGTGAAAAGCATCTC -3'
(R):5'- GCACCTTAGCAGATGGGAATC -3'

Sequencing Primer
(F):5'- TGAGTGAAAAGCATCTCACAGAAAC -3'
(R):5'- TTGACCTAGCAAGCGCAGTG -3'
Posted On2018-05-21