Incidental Mutation 'R6480:Plcd3'
ID517050
Institutional Source Beutler Lab
Gene Symbol Plcd3
Ensembl Gene ENSMUSG00000020937
Gene Namephospholipase C, delta 3
Synonyms2610205J15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.608) question?
Stock #R6480 (G1)
Quality Score148.008
Status Validated
Chromosome11
Chromosomal Location103070304-103101658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103074931 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 492 (S492P)
Ref Sequence ENSEMBL: ENSMUSP00000099366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103077]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103077
AA Change: S492P

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099366
Gene: ENSMUSG00000020937
AA Change: S492P

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 23 38 N/A INTRINSIC
PH 61 170 4.07e-5 SMART
Pfam:EF-hand_10 197 246 1.8e-27 PFAM
Pfam:EF-hand_like 251 332 2.6e-24 PFAM
PLCXc 333 478 7.75e-85 SMART
low complexity region 495 512 N/A INTRINSIC
PLCYc 524 640 3.96e-50 SMART
C2 657 763 1.05e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124740
Predicted Effect unknown
Transcript: ENSMUST00000128650
AA Change: S177P
SMART Domains Protein: ENSMUSP00000117455
Gene: ENSMUSG00000020937
AA Change: S177P

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
PLCXc 19 164 7.75e-85 SMART
coiled coil region 172 206 N/A INTRINSIC
PLCYc 210 326 3.96e-50 SMART
C2 343 449 1.05e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181125
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase C family, which catalyze the hydrolysis of phosphatidylinositol 4,5-bisphosphate to generate the second messengers diacylglycerol and inositol 1,4,5-trisphosphate (IP3). Diacylglycerol and IP3 mediate a variety of cellular responses to extracellular stimuli by inducing protein kinase C and increasing cytosolic Ca(2+) concentrations. This enzyme localizes to the plasma membrane and requires calcium for activation. Its activity is inhibited by spermine, sphingosine, and several phospholipids. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl8b T A 6: 108,815,049 N90K possibly damaging Het
Art3 T C 5: 92,392,817 F140L probably damaging Het
Ascc3 T A 10: 50,710,953 M967K probably damaging Het
Ccne1 G A 7: 38,106,854 probably benign Het
Cdc14b T C 13: 64,225,650 probably null Het
Ceacam2 T A 7: 25,519,989 E282V probably damaging Het
Clk4 T A 11: 51,270,546 C86* probably null Het
Cul2 A C 18: 3,417,561 K115T possibly damaging Het
Dhx29 A T 13: 112,953,788 K800* probably null Het
Dlec1 T C 9: 119,147,690 F1741S probably benign Het
Dnah12 A G 14: 26,872,455 T3455A probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd4 A T 7: 141,294,793 I366F possibly damaging Het
Fam169b T A 7: 68,353,718 Y273* probably null Het
Fbn1 T A 2: 125,335,418 Y1833F probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gjb6 T C 14: 57,124,442 I121V probably benign Het
Glg1 T C 8: 111,197,706 T217A possibly damaging Het
Igkv5-48 A G 6: 69,726,826 S32P probably benign Het
Itgax C A 7: 128,148,599 F1062L probably benign Het
Lct G A 1: 128,294,320 T1494I probably damaging Het
Lilra6 G A 7: 3,912,933 T309I probably damaging Het
Mical3 T C 6: 121,034,275 T321A possibly damaging Het
Mmp23 T A 4: 155,652,341 N104I probably damaging Het
Muc3 T C 5: 137,142,390 Y131C probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ndufs2 A G 1: 171,236,698 S348P probably damaging Het
Nepro T C 16: 44,727,075 S52P probably damaging Het
Nlrp6 A G 7: 140,927,443 E874G possibly damaging Het
Nsmce1 A G 7: 125,491,418 V9A probably benign Het
Olfr13 T C 6: 43,174,066 F27L probably benign Het
Olfr1458 T A 19: 13,102,474 T277S probably benign Het
Olfr357 T C 2: 36,996,995 F62L probably benign Het
Olfr788 A T 10: 129,472,721 I10F possibly damaging Het
Per2 A T 1: 91,429,382 probably null Het
Pgbd1 T C 13: 21,423,476 I183V probably benign Het
Pik3c2g T C 6: 139,730,469 V113A probably benign Het
Pipox A G 11: 77,882,648 L259P probably damaging Het
Pkd1l3 C T 8: 109,638,387 Q1124* probably null Het
Rcor2 T G 19: 7,271,046 M142R probably benign Het
Rwdd3 T C 3: 121,156,452 E115G probably damaging Het
Slc13a3 T C 2: 165,408,898 Y475C probably damaging Het
Slc14a2 A T 18: 78,159,082 I611N possibly damaging Het
Slc25a24 G T 3: 109,136,301 M91I probably damaging Het
Spg11 T C 2: 122,092,305 S888G probably benign Het
Spta1 A T 1: 174,187,148 probably null Het
Stk35 C A 2: 129,810,687 D369E possibly damaging Het
Tanc1 T C 2: 59,807,642 S889P probably damaging Het
Tbc1d10b T C 7: 127,198,878 N697S probably damaging Het
Tcof1 A T 18: 60,814,780 probably null Het
Tg T A 15: 66,671,311 Y25N probably damaging Het
Thbs1 T C 2: 118,119,117 C563R probably damaging Het
Tlr11 A G 14: 50,363,055 S833G possibly damaging Het
Uggt2 T A 14: 119,057,564 H550L probably benign Het
Utp20 A G 10: 88,755,186 probably null Het
Wbp1l T A 19: 46,654,319 L253Q probably damaging Het
Zfp433 T A 10: 81,720,244 S161R possibly damaging Het
Zfp865 A G 7: 5,029,783 T256A probably damaging Het
Zpr1 A G 9: 46,274,711 D160G probably benign Het
Other mutations in Plcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Plcd3 APN 11 103077870 missense probably benign 0.16
IGL01906:Plcd3 APN 11 103076856 missense probably damaging 1.00
IGL02325:Plcd3 APN 11 103080621 nonsense probably null
IGL02634:Plcd3 APN 11 103077827 missense probably damaging 1.00
IGL02852:Plcd3 APN 11 103073805 missense probably damaging 1.00
IGL03025:Plcd3 APN 11 103074898 missense probably benign 0.24
IGL02837:Plcd3 UTSW 11 103071103 missense possibly damaging 0.92
IGL02988:Plcd3 UTSW 11 103076742 missense probably benign
R0055:Plcd3 UTSW 11 103077585 missense probably damaging 1.00
R0055:Plcd3 UTSW 11 103077585 missense probably damaging 1.00
R0062:Plcd3 UTSW 11 103074894 missense probably benign
R0452:Plcd3 UTSW 11 103071259 unclassified probably benign
R0529:Plcd3 UTSW 11 103080187 missense probably benign 0.00
R0556:Plcd3 UTSW 11 103077806 missense probably damaging 1.00
R1463:Plcd3 UTSW 11 103078373 missense probably damaging 1.00
R1752:Plcd3 UTSW 11 103080259 missense probably benign 0.01
R2157:Plcd3 UTSW 11 103071148 missense probably benign
R2519:Plcd3 UTSW 11 103080400 missense possibly damaging 0.80
R3809:Plcd3 UTSW 11 103101383 missense probably null 0.03
R4167:Plcd3 UTSW 11 103078464 missense probably damaging 0.98
R5100:Plcd3 UTSW 11 103078349 missense probably benign
R5387:Plcd3 UTSW 11 103078455 missense probably damaging 1.00
R5589:Plcd3 UTSW 11 103077803 missense probably benign 0.01
R5700:Plcd3 UTSW 11 103073763 missense probably benign 0.00
R5754:Plcd3 UTSW 11 103073766 missense possibly damaging 0.67
R5936:Plcd3 UTSW 11 103078347 missense probably damaging 1.00
R6059:Plcd3 UTSW 11 103080401 missense possibly damaging 0.80
R6102:Plcd3 UTSW 11 103080644 missense probably damaging 0.99
R6481:Plcd3 UTSW 11 103077767 missense probably damaging 1.00
R6566:Plcd3 UTSW 11 103073800 missense probably damaging 1.00
R7098:Plcd3 UTSW 11 103077863 missense probably damaging 1.00
R7165:Plcd3 UTSW 11 103079613 missense probably damaging 1.00
X0023:Plcd3 UTSW 11 103080208 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGGATCACTAAGCTCAAGAG -3'
(R):5'- TCCTGTTAGGAACAAGCACTC -3'

Sequencing Primer
(F):5'- TCAAGAGCCCCTCCCCC -3'
(R):5'- TGTTAGGAACAAGCACTCCAGTC -3'
Posted On2018-05-21