Incidental Mutation 'R6480:Dnah12'
ID517055
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Namedynein, axonemal, heavy chain 12
SynonymsDHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R6480 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location26693274-26891703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26872455 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 3455 (T3455A)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
Predicted Effect probably damaging
Transcript: ENSMUST00000022433
AA Change: T3455A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: T3455A

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl8b T A 6: 108,815,049 N90K possibly damaging Het
Art3 T C 5: 92,392,817 F140L probably damaging Het
Ascc3 T A 10: 50,710,953 M967K probably damaging Het
Ccne1 G A 7: 38,106,854 probably benign Het
Cdc14b T C 13: 64,225,650 probably null Het
Ceacam2 T A 7: 25,519,989 E282V probably damaging Het
Clk4 T A 11: 51,270,546 C86* probably null Het
Cul2 A C 18: 3,417,561 K115T possibly damaging Het
Dhx29 A T 13: 112,953,788 K800* probably null Het
Dlec1 T C 9: 119,147,690 F1741S probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd4 A T 7: 141,294,793 I366F possibly damaging Het
Fam169b T A 7: 68,353,718 Y273* probably null Het
Fbn1 T A 2: 125,335,418 Y1833F probably benign Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gjb6 T C 14: 57,124,442 I121V probably benign Het
Glg1 T C 8: 111,197,706 T217A possibly damaging Het
Igkv5-48 A G 6: 69,726,826 S32P probably benign Het
Itgax C A 7: 128,148,599 F1062L probably benign Het
Lct G A 1: 128,294,320 T1494I probably damaging Het
Lilra6 G A 7: 3,912,933 T309I probably damaging Het
Mical3 T C 6: 121,034,275 T321A possibly damaging Het
Mmp23 T A 4: 155,652,341 N104I probably damaging Het
Muc3 T C 5: 137,142,390 Y131C probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Ndufs2 A G 1: 171,236,698 S348P probably damaging Het
Nepro T C 16: 44,727,075 S52P probably damaging Het
Nlrp6 A G 7: 140,927,443 E874G possibly damaging Het
Nsmce1 A G 7: 125,491,418 V9A probably benign Het
Olfr13 T C 6: 43,174,066 F27L probably benign Het
Olfr1458 T A 19: 13,102,474 T277S probably benign Het
Olfr357 T C 2: 36,996,995 F62L probably benign Het
Olfr788 A T 10: 129,472,721 I10F possibly damaging Het
Per2 A T 1: 91,429,382 probably null Het
Pgbd1 T C 13: 21,423,476 I183V probably benign Het
Pik3c2g T C 6: 139,730,469 V113A probably benign Het
Pipox A G 11: 77,882,648 L259P probably damaging Het
Pkd1l3 C T 8: 109,638,387 Q1124* probably null Het
Plcd3 A G 11: 103,074,931 S492P possibly damaging Het
Rcor2 T G 19: 7,271,046 M142R probably benign Het
Rwdd3 T C 3: 121,156,452 E115G probably damaging Het
Slc13a3 T C 2: 165,408,898 Y475C probably damaging Het
Slc14a2 A T 18: 78,159,082 I611N possibly damaging Het
Slc25a24 G T 3: 109,136,301 M91I probably damaging Het
Spg11 T C 2: 122,092,305 S888G probably benign Het
Spta1 A T 1: 174,187,148 probably null Het
Stk35 C A 2: 129,810,687 D369E possibly damaging Het
Tanc1 T C 2: 59,807,642 S889P probably damaging Het
Tbc1d10b T C 7: 127,198,878 N697S probably damaging Het
Tcof1 A T 18: 60,814,780 probably null Het
Tg T A 15: 66,671,311 Y25N probably damaging Het
Thbs1 T C 2: 118,119,117 C563R probably damaging Het
Tlr11 A G 14: 50,363,055 S833G possibly damaging Het
Uggt2 T A 14: 119,057,564 H550L probably benign Het
Utp20 A G 10: 88,755,186 probably null Het
Wbp1l T A 19: 46,654,319 L253Q probably damaging Het
Zfp433 T A 10: 81,720,244 S161R possibly damaging Het
Zfp865 A G 7: 5,029,783 T256A probably damaging Het
Zpr1 A G 9: 46,274,711 D160G probably benign Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26771005 missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26710275 splice site probably benign
IGL01681:Dnah12 APN 14 26722160 missense probably benign
IGL02082:Dnah12 APN 14 26707162 missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26716577 missense probably benign 0.20
IGL02170:Dnah12 APN 14 26773112 missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26706917 missense probably benign 0.00
IGL02367:Dnah12 APN 14 26709161 missense probably benign 0.30
IGL02418:Dnah12 APN 14 26773722 missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26724512 missense probably benign 0.02
IGL03066:Dnah12 APN 14 26697398 missense probably benign 0.06
F5770:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26872740 missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26772644 missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26799999 missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26706117 intron probably null
R0364:Dnah12 UTSW 14 26724473 missense probably benign 0.10
R0469:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26709310 missense probably benign 0.00
R0709:Dnah12 UTSW 14 26884265 splice site probably benign
R0734:Dnah12 UTSW 14 26800013 missense probably benign 0.00
R1273:Dnah12 UTSW 14 26739220 nonsense probably null
R1496:Dnah12 UTSW 14 26710248 missense probably benign
R1503:Dnah12 UTSW 14 26773692 missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26816322 missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26766190 missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26778883 missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26766114 missense probably benign 0.02
R1826:Dnah12 UTSW 14 26711019 missense probably benign 0.01
R1829:Dnah12 UTSW 14 26773023 missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26800075 missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26697398 missense probably benign 0.06
R1862:Dnah12 UTSW 14 26709257 missense probably benign 0.30
R1913:Dnah12 UTSW 14 26792264 splice site probably null
R1933:Dnah12 UTSW 14 26734495 missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26814459 missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26781528 missense probably null 1.00
R2113:Dnah12 UTSW 14 26766141 missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26724458 nonsense probably null
R2126:Dnah12 UTSW 14 26724458 nonsense probably null
R2207:Dnah12 UTSW 14 26781787 missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26739330 missense probably benign 0.06
R2511:Dnah12 UTSW 14 26769950 missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26693470 missense probably benign 0.04
R2875:Dnah12 UTSW 14 26876950 missense probably benign 0.05
R3551:Dnah12 UTSW 14 26770972 missense probably benign 0.01
R3713:Dnah12 UTSW 14 26812790 missense probably benign
R3729:Dnah12 UTSW 14 26706065 missense probably benign 0.02
R3799:Dnah12 UTSW 14 26770923 missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26710211 missense probably benign 0.00
R3892:Dnah12 UTSW 14 26856616 missense probably benign 0.03
R3921:Dnah12 UTSW 14 26771051 missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26723599 missense probably benign
R4065:Dnah12 UTSW 14 26770448 missense probably benign 0.02
R4113:Dnah12 UTSW 14 26693567 missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26709186 missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4260:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4348:Dnah12 UTSW 14 26814541 missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26815507 missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26871855 missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26770022 missense probably damaging 0.97
R4523:Dnah12 UTSW 14 26876958 missense possibly damaging 0.83
R4546:Dnah12 UTSW 14 26773014 missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26772594 missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26735758 missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26706839 missense probably benign 0.00
R4727:Dnah12 UTSW 14 26872317 missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26716629 nonsense probably null
R4879:Dnah12 UTSW 14 26718046 critical splice donor site probably null
R4893:Dnah12 UTSW 14 26710170 missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26734570 missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26861805 nonsense probably null
R4939:Dnah12 UTSW 14 26891524 missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26716700 missense probably benign 0.00
R5011:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5013:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5043:Dnah12 UTSW 14 26884190 missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26735697 missense probably benign 0.09
R5122:Dnah12 UTSW 14 26718000 missense probably benign 0.00
R5135:Dnah12 UTSW 14 26770477 missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26850926 nonsense probably null
R5154:Dnah12 UTSW 14 26849363 missense probably benign 0.12
R5206:Dnah12 UTSW 14 26769985 missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26693486 missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26773830 missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26879738 missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26814537 missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26774342 splice site probably null
R5389:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26859299 missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26771050 missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26710269 missense probably benign 0.01
R5681:Dnah12 UTSW 14 26815495 missense probably benign 0.32
R5824:Dnah12 UTSW 14 26770518 critical splice donor site probably null
R5863:Dnah12 UTSW 14 26854921 missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26706884 missense probably benign 0.09
R5912:Dnah12 UTSW 14 26770008 nonsense probably null
R5916:Dnah12 UTSW 14 26706918 missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26706867 missense probably benign 0.00
R5987:Dnah12 UTSW 14 26886871 missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26697341 missense probably benign 0.04
R6132:Dnah12 UTSW 14 26717911 missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26875270 missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26773685 missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26861769 missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26710257 missense probably benign 0.03
R6235:Dnah12 UTSW 14 26854804 missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26770482 missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26717974 missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26706834 missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26878051 missense probably benign 0.06
R6530:Dnah12 UTSW 14 26735710 missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26735692 missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26872749 missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26796223 missense probably benign 0.02
R6745:Dnah12 UTSW 14 26707228 missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26801513 missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26878079 missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26799076 intron probably null
R7001:Dnah12 UTSW 14 26879724 missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26876998 missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26735680 missense probably benign
R7107:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7108:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7121:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7122:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26801413 missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26861732 missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26814413 missense probably benign 0.04
R7201:Dnah12 UTSW 14 26814622 missense probably benign 0.08
R7202:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26781485 missense probably damaging 0.99
R7205:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7206:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7219:Dnah12 UTSW 14 26854880 missense probably damaging 0.99
V7580:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26814480 missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26816288 missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26814645 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAGCTATTTCACTGGGACAAGGG -3'
(R):5'- TGTTACTGGGAACTAAGACGAAAC -3'

Sequencing Primer
(F):5'- TATTTCACTGGGACAAGGGCAAGG -3'
(R):5'- TACTGGGAACTAAGACGAAACAAATG -3'
Posted On2018-05-21