Incidental Mutation 'R6481:Rab17'
ID517069
Institutional Source Beutler Lab
Gene Symbol Rab17
Ensembl Gene ENSMUSG00000026304
Gene NameRAB17, member RAS oncogene family
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6481 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location90958133-90969661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 90958961 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 190 (S190R)
Ref Sequence ENSEMBL: ENSMUSP00000122178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027529] [ENSMUST00000130042] [ENSMUST00000131428] [ENSMUST00000166281]
Predicted Effect probably benign
Transcript: ENSMUST00000027529
AA Change: S190R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000027529
Gene: ENSMUSG00000026304
AA Change: S190R

DomainStartEndE-ValueType
RAB 21 183 2.17e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128226
Predicted Effect probably benign
Transcript: ENSMUST00000130042
SMART Domains Protein: ENSMUSP00000114240
Gene: ENSMUSG00000026304

DomainStartEndE-ValueType
Pfam:Arf 11 143 6.3e-17 PFAM
Pfam:Miro 21 135 4.2e-19 PFAM
Pfam:Gtr1_RagA 21 145 1.8e-7 PFAM
Pfam:Ras 21 145 4.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131428
AA Change: S190R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122178
Gene: ENSMUSG00000026304
AA Change: S190R

DomainStartEndE-ValueType
RAB 21 183 2.17e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135819
Predicted Effect probably benign
Transcript: ENSMUST00000166281
SMART Domains Protein: ENSMUSP00000130768
Gene: ENSMUSG00000090550

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Prolactin_RP 23 67 1.5e-30 PFAM
Meta Mutation Damage Score 0.0396 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Rab subfamily of small GTPases plays an important role in the regulation of membrane trafficking. RAB17 is an epithelial cell-specific GTPase (Lutcke et al., 1993 [PubMed 8486736]).[supplied by OMIM, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428L18Rik T C 1: 31,222,507 probably benign Het
5430419D17Rik A T 7: 131,256,801 D1066V probably benign Het
6430573F11Rik T C 8: 36,498,483 probably null Het
Abca9 G A 11: 110,165,962 Q11* probably null Het
Abcc9 A T 6: 142,604,895 M1273K probably damaging Het
Abi2 A G 1: 60,438,939 probably null Het
Acsm5 A G 7: 119,534,881 E295G probably benign Het
Anapc5 T C 5: 122,800,544 D389G probably benign Het
Ano3 A T 2: 110,795,027 D159E probably benign Het
Arhgap26 T A 18: 39,150,057 M349K probably damaging Het
Arhgef39 A G 4: 43,498,580 probably null Het
Astn1 T C 1: 158,612,462 S867P probably benign Het
Atad3a A T 4: 155,753,641 probably null Het
Cadm1 A T 9: 47,788,109 D91V probably damaging Het
Cc2d2b T C 19: 40,802,395 I933T possibly damaging Het
Celsr3 C G 9: 108,837,084 N1937K possibly damaging Het
Cic A C 7: 25,288,281 T558P possibly damaging Het
Cntln A G 4: 85,067,510 M933V probably benign Het
Coch T C 12: 51,598,173 F170S probably damaging Het
Col1a2 A G 6: 4,538,680 Y1200C unknown Het
Col26a1 T C 5: 136,744,178 M383V probably benign Het
Col4a4 A T 1: 82,453,778 M1595K unknown Het
Crh T C 3: 19,694,337 E47G probably benign Het
Cyhr1 T C 15: 76,658,708 probably null Het
D930020B18Rik T C 10: 121,661,148 probably null Het
Def6 G A 17: 28,226,163 R482H probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpagt1 T C 9: 44,331,190 L241P probably damaging Het
E2f7 A G 10: 110,774,681 E389G probably damaging Het
Eif2b1 T C 5: 124,577,111 I53V probably benign Het
Fbxo4 A G 15: 3,965,734 L376P probably damaging Het
Fgfr2 A G 7: 130,185,278 S352P possibly damaging Het
Fkbpl C A 17: 34,645,414 P52Q possibly damaging Het
Fry G A 5: 150,386,014 R641H probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm12728 A G 4: 105,794,349 K52R probably damaging Het
Gm8298 T C 3: 59,861,057 Y3H probably benign Het
Gtf2a1l A G 17: 88,711,625 D379G probably benign Het
Gys1 A T 7: 45,442,969 Y332F possibly damaging Het
Hoxa7 T A 6: 52,216,614 probably benign Het
Ifitm1 G A 7: 140,969,606 V101I probably benign Het
Kalrn T A 16: 34,360,984 T95S probably damaging Het
Leng8 A G 7: 4,145,413 Y728C probably damaging Het
Lonp2 G T 8: 86,634,908 D238Y possibly damaging Het
Ltn1 A C 16: 87,378,980 S1757A probably damaging Het
Man2a2 A T 7: 80,364,071 S411T probably damaging Het
Mrps33 C A 6: 39,805,370 probably null Het
Muc16 C T 9: 18,550,677 probably null Het
Muc5ac A G 7: 141,809,071 probably benign Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Olfr1141 T C 2: 87,753,468 N175S probably damaging Het
Olfr1204 A T 2: 88,852,519 T190S probably damaging Het
Olfr122 T G 17: 37,772,303 F217V probably damaging Het
Olfr1340 A G 4: 118,726,733 Y162C probably damaging Het
Olfr50 T A 2: 36,793,777 D180E possibly damaging Het
Olfr545 A T 7: 102,494,139 V212D probably damaging Het
Pag1 T A 3: 9,699,336 E252D possibly damaging Het
Plcd3 T C 11: 103,077,767 Y366C probably damaging Het
Psg17 A C 7: 18,814,450 S465R probably damaging Het
Ptpn9 G T 9: 57,023,040 V50L probably damaging Het
Samd11 A G 4: 156,249,078 probably null Het
Slc17a5 A G 9: 78,538,271 F434S possibly damaging Het
Slc22a15 A G 3: 101,883,583 I202T possibly damaging Het
Slc8a1 G T 17: 81,388,918 Q896K probably benign Het
Slc9a5 A T 8: 105,358,393 K509* probably null Het
Slf2 A C 19: 44,973,164 M1041L probably benign Het
Smn1 A G 13: 100,128,500 probably null Het
Snx9 T C 17: 5,922,209 probably null Het
Soat2 T A 15: 102,162,055 L431Q probably damaging Het
Spam1 T A 6: 24,796,930 N293K probably benign Het
Tatdn1 T C 15: 58,923,911 T66A possibly damaging Het
Tmprss11g A T 5: 86,492,156 S205T probably benign Het
Tnpo3 G T 6: 29,571,101 N431K possibly damaging Het
Trim39 T C 17: 36,268,662 T31A probably benign Het
Tshz3 A G 7: 36,752,339 probably null Het
Ttll11 G A 2: 35,902,754 T359M probably damaging Het
Ttn T G 2: 76,741,499 D26350A probably damaging Het
Ubr4 G T 4: 139,431,751 V2472F probably damaging Het
Vsx2 C T 12: 84,593,104 P265S probably benign Het
Wdr90 C T 17: 25,845,911 G1708R probably damaging Het
Wnt11 A G 7: 98,853,274 Y351C probably damaging Het
Xpo6 A C 7: 126,112,885 N3K probably damaging Het
Zfp445 A G 9: 122,857,566 S165P probably benign Het
Zfp953 A T 13: 67,347,937 Y13* probably null Het
Other mutations in Rab17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Rab17 APN 1 90960093 missense probably damaging 0.98
IGL02672:Rab17 APN 1 90959218 missense probably damaging 1.00
R2140:Rab17 UTSW 1 90960078 missense probably benign 0.05
R2389:Rab17 UTSW 1 90964204 missense probably benign 0.09
R5031:Rab17 UTSW 1 90960138 splice site probably null
R5685:Rab17 UTSW 1 90958957 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGATTTGCCACAAAGACG -3'
(R):5'- CAGGTGTCTGAGATCTTCAACAC -3'

Sequencing Primer
(F):5'- ATTTGCCACAAAGACGTAGTAGC -3'
(R):5'- CAACACTGTTGGTGAGTTACAGCC -3'
Posted On2018-05-21