Incidental Mutation 'R6481:Hoxa7'
ID517096
Institutional Source Beutler Lab
Gene Symbol Hoxa7
Ensembl Gene ENSMUSG00000038236
Gene Namehomeobox A7
SynonymsHox-1.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6481 (G1)
Quality Score172.009
Status Validated
Chromosome6
Chromosomal Location52214491-52221854 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 52216614 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048715] [ENSMUST00000114434] [ENSMUST00000128102] [ENSMUST00000134367] [ENSMUST00000140316] [ENSMUST00000150041] [ENSMUST00000153280]
Predicted Effect probably benign
Transcript: ENSMUST00000048715
SMART Domains Protein: ENSMUSP00000048648
Gene: ENSMUSG00000038236

DomainStartEndE-ValueType
HOX 129 191 1.72e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114434
SMART Domains Protein: ENSMUSP00000110077
Gene: ENSMUSG00000079560

DomainStartEndE-ValueType
low complexity region 76 131 N/A INTRINSIC
HOX 192 254 3.35e-28 SMART
low complexity region 287 302 N/A INTRINSIC
low complexity region 304 326 N/A INTRINSIC
Pfam:DUF4074 377 441 9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131502
Predicted Effect probably benign
Transcript: ENSMUST00000134367
SMART Domains Protein: ENSMUSP00000134610
Gene: ENSMUSG00000038236

DomainStartEndE-ValueType
HOX 8 70 1.72e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136806
Predicted Effect unknown
Transcript: ENSMUST00000140316
AA Change: D141V
SMART Domains Protein: ENSMUSP00000138790
Gene: ENSMUSG00000038236
AA Change: D141V

DomainStartEndE-ValueType
low complexity region 132 158 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142764
Predicted Effect probably benign
Transcript: ENSMUST00000150041
SMART Domains Protein: ENSMUSP00000140519
Gene: ENSMUSG00000038236

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 43 56 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153280
SMART Domains Protein: ENSMUSP00000134641
Gene: ENSMUSG00000038236

DomainStartEndE-ValueType
HOX 8 70 1.72e-25 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. For example, the encoded protein represses the transcription of differentiation-specific genes during keratinocyte proliferation, but this repression is then overcome by differentiation signals. This gene is highly similar to the antennapedia (Antp) gene of Drosophila. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal with no apparent skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428L18Rik T C 1: 31,222,507 probably benign Het
5430419D17Rik A T 7: 131,256,801 D1066V probably benign Het
6430573F11Rik T C 8: 36,498,483 probably null Het
Abca9 G A 11: 110,165,962 Q11* probably null Het
Abcc9 A T 6: 142,604,895 M1273K probably damaging Het
Abi2 A G 1: 60,438,939 probably null Het
Acsm5 A G 7: 119,534,881 E295G probably benign Het
Anapc5 T C 5: 122,800,544 D389G probably benign Het
Ano3 A T 2: 110,795,027 D159E probably benign Het
Arhgap26 T A 18: 39,150,057 M349K probably damaging Het
Arhgef39 A G 4: 43,498,580 probably null Het
Astn1 T C 1: 158,612,462 S867P probably benign Het
Atad3a A T 4: 155,753,641 probably null Het
Cadm1 A T 9: 47,788,109 D91V probably damaging Het
Cc2d2b T C 19: 40,802,395 I933T possibly damaging Het
Celsr3 C G 9: 108,837,084 N1937K possibly damaging Het
Cic A C 7: 25,288,281 T558P possibly damaging Het
Cntln A G 4: 85,067,510 M933V probably benign Het
Coch T C 12: 51,598,173 F170S probably damaging Het
Col1a2 A G 6: 4,538,680 Y1200C unknown Het
Col26a1 T C 5: 136,744,178 M383V probably benign Het
Col4a4 A T 1: 82,453,778 M1595K unknown Het
Crh T C 3: 19,694,337 E47G probably benign Het
Cyhr1 T C 15: 76,658,708 probably null Het
D930020B18Rik T C 10: 121,661,148 probably null Het
Def6 G A 17: 28,226,163 R482H probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpagt1 T C 9: 44,331,190 L241P probably damaging Het
E2f7 A G 10: 110,774,681 E389G probably damaging Het
Eif2b1 T C 5: 124,577,111 I53V probably benign Het
Fbxo4 A G 15: 3,965,734 L376P probably damaging Het
Fgfr2 A G 7: 130,185,278 S352P possibly damaging Het
Fkbpl C A 17: 34,645,414 P52Q possibly damaging Het
Fry G A 5: 150,386,014 R641H probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm12728 A G 4: 105,794,349 K52R probably damaging Het
Gm8298 T C 3: 59,861,057 Y3H probably benign Het
Gtf2a1l A G 17: 88,711,625 D379G probably benign Het
Gys1 A T 7: 45,442,969 Y332F possibly damaging Het
Ifitm1 G A 7: 140,969,606 V101I probably benign Het
Kalrn T A 16: 34,360,984 T95S probably damaging Het
Leng8 A G 7: 4,145,413 Y728C probably damaging Het
Lonp2 G T 8: 86,634,908 D238Y possibly damaging Het
Ltn1 A C 16: 87,378,980 S1757A probably damaging Het
Man2a2 A T 7: 80,364,071 S411T probably damaging Het
Mrps33 C A 6: 39,805,370 probably null Het
Muc16 C T 9: 18,550,677 probably null Het
Muc5ac A G 7: 141,809,071 probably benign Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Olfr1141 T C 2: 87,753,468 N175S probably damaging Het
Olfr1204 A T 2: 88,852,519 T190S probably damaging Het
Olfr122 T G 17: 37,772,303 F217V probably damaging Het
Olfr1340 A G 4: 118,726,733 Y162C probably damaging Het
Olfr50 T A 2: 36,793,777 D180E possibly damaging Het
Olfr545 A T 7: 102,494,139 V212D probably damaging Het
Pag1 T A 3: 9,699,336 E252D possibly damaging Het
Plcd3 T C 11: 103,077,767 Y366C probably damaging Het
Psg17 A C 7: 18,814,450 S465R probably damaging Het
Ptpn9 G T 9: 57,023,040 V50L probably damaging Het
Rab17 T G 1: 90,958,961 S190R probably benign Het
Samd11 A G 4: 156,249,078 probably null Het
Slc17a5 A G 9: 78,538,271 F434S possibly damaging Het
Slc22a15 A G 3: 101,883,583 I202T possibly damaging Het
Slc8a1 G T 17: 81,388,918 Q896K probably benign Het
Slc9a5 A T 8: 105,358,393 K509* probably null Het
Slf2 A C 19: 44,973,164 M1041L probably benign Het
Smn1 A G 13: 100,128,500 probably null Het
Snx9 T C 17: 5,922,209 probably null Het
Soat2 T A 15: 102,162,055 L431Q probably damaging Het
Spam1 T A 6: 24,796,930 N293K probably benign Het
Tatdn1 T C 15: 58,923,911 T66A possibly damaging Het
Tmprss11g A T 5: 86,492,156 S205T probably benign Het
Tnpo3 G T 6: 29,571,101 N431K possibly damaging Het
Trim39 T C 17: 36,268,662 T31A probably benign Het
Tshz3 A G 7: 36,752,339 probably null Het
Ttll11 G A 2: 35,902,754 T359M probably damaging Het
Ttn T G 2: 76,741,499 D26350A probably damaging Het
Ubr4 G T 4: 139,431,751 V2472F probably damaging Het
Vsx2 C T 12: 84,593,104 P265S probably benign Het
Wdr90 C T 17: 25,845,911 G1708R probably damaging Het
Wnt11 A G 7: 98,853,274 Y351C probably damaging Het
Xpo6 A C 7: 126,112,885 N3K probably damaging Het
Zfp445 A G 9: 122,857,566 S165P probably benign Het
Zfp953 A T 13: 67,347,937 Y13* probably null Het
Other mutations in Hoxa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Hoxa7 APN 6 52217306 missense possibly damaging 0.95
IGL02179:Hoxa7 APN 6 52215874 missense probably damaging 1.00
R0022:Hoxa7 UTSW 6 52217383 missense probably damaging 0.98
R0022:Hoxa7 UTSW 6 52217383 missense probably damaging 0.98
R1830:Hoxa7 UTSW 6 52217327 missense possibly damaging 0.94
R3944:Hoxa7 UTSW 6 52216626 intron probably benign
R4211:Hoxa7 UTSW 6 52216625 nonsense probably null
R4880:Hoxa7 UTSW 6 52217034 utr 3 prime probably benign
R5810:Hoxa7 UTSW 6 52216024 missense probably benign 0.02
R6009:Hoxa7 UTSW 6 52217387 missense probably damaging 1.00
R6532:Hoxa7 UTSW 6 52217315 missense probably benign 0.05
R6724:Hoxa7 UTSW 6 52215739 missense probably benign
R7133:Hoxa7 UTSW 6 52215740 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCACAAGACCTTCCTGTGAC -3'
(R):5'- CCGTAGCATTGTATGTAAATGAGG -3'

Sequencing Primer
(F):5'- ACAAGACCTTCCTGTGACTTTCC -3'
(R):5'- CAATTAATGGGTTCGATCCTCG -3'
Posted On2018-05-21