Incidental Mutation 'R6481:Lonp2'
ID517112
Institutional Source Beutler Lab
Gene Symbol Lonp2
Ensembl Gene ENSMUSG00000047866
Gene Namelon peptidase 2, peroxisomal
Synonyms1300002A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R6481 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location86624043-86723873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86634908 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 238 (D238Y)
Ref Sequence ENSEMBL: ENSMUSP00000118737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034141] [ENSMUST00000122188] [ENSMUST00000155433]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034141
AA Change: D238Y

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034141
Gene: ENSMUSG00000047866
AA Change: D238Y

DomainStartEndE-ValueType
Pfam:LON_substr_bdg 12 220 1e-24 PFAM
low complexity region 243 255 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
AAA 367 512 1.59e-10 SMART
low complexity region 538 545 N/A INTRINSIC
Pfam:Lon_C 628 837 1.6e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122188
SMART Domains Protein: ENSMUSP00000113834
Gene: ENSMUSG00000047866

DomainStartEndE-ValueType
Pfam:LON 12 224 9e-17 PFAM
AAA 225 370 1.59e-10 SMART
low complexity region 396 403 N/A INTRINSIC
Pfam:Lon_C 486 695 1.5e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124911
Predicted Effect possibly damaging
Transcript: ENSMUST00000155433
AA Change: D238Y

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118737
Gene: ENSMUSG00000047866
AA Change: D238Y

DomainStartEndE-ValueType
Pfam:LON 12 220 3.3e-26 PFAM
low complexity region 243 255 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
AAA 367 512 1.59e-10 SMART
low complexity region 538 545 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155501
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, peroxisomes function primarily to catalyze fatty acid beta-oxidation and, as a by-product, produce hydrogen peroxide and superoxide. The protein encoded by this gene is an ATP-dependent protease that likely plays a role in maintaining overall peroxisome homeostasis as well as proteolytically degrading peroxisomal proteins damaged by oxidation. The protein has an N-terminal Lon N substrate recognition domain, an ATPase domain, a proteolytic domain, and, in some isoforms, a C-terminal peroxisome targeting sequence. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428L18Rik T C 1: 31,222,507 probably benign Het
5430419D17Rik A T 7: 131,256,801 D1066V probably benign Het
6430573F11Rik T C 8: 36,498,483 probably null Het
Abca9 G A 11: 110,165,962 Q11* probably null Het
Abcc9 A T 6: 142,604,895 M1273K probably damaging Het
Abi2 A G 1: 60,438,939 probably null Het
Acsm5 A G 7: 119,534,881 E295G probably benign Het
Anapc5 T C 5: 122,800,544 D389G probably benign Het
Ano3 A T 2: 110,795,027 D159E probably benign Het
Arhgap26 T A 18: 39,150,057 M349K probably damaging Het
Arhgef39 A G 4: 43,498,580 probably null Het
Astn1 T C 1: 158,612,462 S867P probably benign Het
Atad3a A T 4: 155,753,641 probably null Het
Cadm1 A T 9: 47,788,109 D91V probably damaging Het
Cc2d2b T C 19: 40,802,395 I933T possibly damaging Het
Celsr3 C G 9: 108,837,084 N1937K possibly damaging Het
Cic A C 7: 25,288,281 T558P possibly damaging Het
Cntln A G 4: 85,067,510 M933V probably benign Het
Coch T C 12: 51,598,173 F170S probably damaging Het
Col1a2 A G 6: 4,538,680 Y1200C unknown Het
Col26a1 T C 5: 136,744,178 M383V probably benign Het
Col4a4 A T 1: 82,453,778 M1595K unknown Het
Crh T C 3: 19,694,337 E47G probably benign Het
Cyhr1 T C 15: 76,658,708 probably null Het
D930020B18Rik T C 10: 121,661,148 probably null Het
Def6 G A 17: 28,226,163 R482H probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpagt1 T C 9: 44,331,190 L241P probably damaging Het
E2f7 A G 10: 110,774,681 E389G probably damaging Het
Eif2b1 T C 5: 124,577,111 I53V probably benign Het
Fbxo4 A G 15: 3,965,734 L376P probably damaging Het
Fgfr2 A G 7: 130,185,278 S352P possibly damaging Het
Fkbpl C A 17: 34,645,414 P52Q possibly damaging Het
Fry G A 5: 150,386,014 R641H probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm12728 A G 4: 105,794,349 K52R probably damaging Het
Gm8298 T C 3: 59,861,057 Y3H probably benign Het
Gtf2a1l A G 17: 88,711,625 D379G probably benign Het
Gys1 A T 7: 45,442,969 Y332F possibly damaging Het
Hoxa7 T A 6: 52,216,614 probably benign Het
Ifitm1 G A 7: 140,969,606 V101I probably benign Het
Kalrn T A 16: 34,360,984 T95S probably damaging Het
Leng8 A G 7: 4,145,413 Y728C probably damaging Het
Ltn1 A C 16: 87,378,980 S1757A probably damaging Het
Man2a2 A T 7: 80,364,071 S411T probably damaging Het
Mrps33 C A 6: 39,805,370 probably null Het
Muc16 C T 9: 18,550,677 probably null Het
Muc5ac A G 7: 141,809,071 probably benign Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Olfr1141 T C 2: 87,753,468 N175S probably damaging Het
Olfr1204 A T 2: 88,852,519 T190S probably damaging Het
Olfr122 T G 17: 37,772,303 F217V probably damaging Het
Olfr1340 A G 4: 118,726,733 Y162C probably damaging Het
Olfr50 T A 2: 36,793,777 D180E possibly damaging Het
Olfr545 A T 7: 102,494,139 V212D probably damaging Het
Pag1 T A 3: 9,699,336 E252D possibly damaging Het
Plcd3 T C 11: 103,077,767 Y366C probably damaging Het
Psg17 A C 7: 18,814,450 S465R probably damaging Het
Ptpn9 G T 9: 57,023,040 V50L probably damaging Het
Rab17 T G 1: 90,958,961 S190R probably benign Het
Samd11 A G 4: 156,249,078 probably null Het
Slc17a5 A G 9: 78,538,271 F434S possibly damaging Het
Slc22a15 A G 3: 101,883,583 I202T possibly damaging Het
Slc8a1 G T 17: 81,388,918 Q896K probably benign Het
Slc9a5 A T 8: 105,358,393 K509* probably null Het
Slf2 A C 19: 44,973,164 M1041L probably benign Het
Smn1 A G 13: 100,128,500 probably null Het
Snx9 T C 17: 5,922,209 probably null Het
Soat2 T A 15: 102,162,055 L431Q probably damaging Het
Spam1 T A 6: 24,796,930 N293K probably benign Het
Tatdn1 T C 15: 58,923,911 T66A possibly damaging Het
Tmprss11g A T 5: 86,492,156 S205T probably benign Het
Tnpo3 G T 6: 29,571,101 N431K possibly damaging Het
Trim39 T C 17: 36,268,662 T31A probably benign Het
Tshz3 A G 7: 36,752,339 probably null Het
Ttll11 G A 2: 35,902,754 T359M probably damaging Het
Ttn T G 2: 76,741,499 D26350A probably damaging Het
Ubr4 G T 4: 139,431,751 V2472F probably damaging Het
Vsx2 C T 12: 84,593,104 P265S probably benign Het
Wdr90 C T 17: 25,845,911 G1708R probably damaging Het
Wnt11 A G 7: 98,853,274 Y351C probably damaging Het
Xpo6 A C 7: 126,112,885 N3K probably damaging Het
Zfp445 A G 9: 122,857,566 S165P probably benign Het
Zfp953 A T 13: 67,347,937 Y13* probably null Het
Other mutations in Lonp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Lonp2 APN 8 86633972 missense probably damaging 1.00
IGL00990:Lonp2 APN 8 86641533 splice site probably benign
IGL01654:Lonp2 APN 8 86714086 missense probably damaging 1.00
IGL02021:Lonp2 APN 8 86708971 missense probably benign 0.00
IGL02165:Lonp2 APN 8 86709026 missense probably damaging 1.00
IGL02309:Lonp2 APN 8 86634863 missense probably damaging 1.00
IGL02355:Lonp2 APN 8 86624246 missense probably benign 0.17
IGL02362:Lonp2 APN 8 86624246 missense probably benign 0.17
IGL02365:Lonp2 APN 8 86716365 missense possibly damaging 0.69
IGL02374:Lonp2 APN 8 86709045 missense probably damaging 0.97
IGL02440:Lonp2 APN 8 86624185 start codon destroyed probably null 0.98
R0083:Lonp2 UTSW 8 86716355 missense probably benign 0.13
R0108:Lonp2 UTSW 8 86716355 missense probably benign 0.13
R0108:Lonp2 UTSW 8 86716355 missense probably benign 0.13
R0129:Lonp2 UTSW 8 86634890 missense probably damaging 0.99
R0302:Lonp2 UTSW 8 86637991 missense possibly damaging 0.94
R0433:Lonp2 UTSW 8 86633954 missense probably damaging 1.00
R1148:Lonp2 UTSW 8 86636540 missense probably benign 0.00
R1148:Lonp2 UTSW 8 86636540 missense probably benign 0.00
R1413:Lonp2 UTSW 8 86641584 missense probably damaging 1.00
R1589:Lonp2 UTSW 8 86673072 splice site probably benign
R1635:Lonp2 UTSW 8 86713450 missense possibly damaging 0.78
R1654:Lonp2 UTSW 8 86631450 missense probably damaging 0.99
R2033:Lonp2 UTSW 8 86708942 missense possibly damaging 0.77
R2062:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R2065:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R2066:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R2068:Lonp2 UTSW 8 86665775 missense probably damaging 0.99
R4321:Lonp2 UTSW 8 86665728 missense probably damaging 1.00
R4713:Lonp2 UTSW 8 86713315 missense probably damaging 0.98
R4750:Lonp2 UTSW 8 86631502 missense probably benign 0.09
R5790:Lonp2 UTSW 8 86631490 missense probably benign 0.24
R5854:Lonp2 UTSW 8 86673071 critical splice donor site probably null
R5884:Lonp2 UTSW 8 86641626 missense probably damaging 1.00
R6025:Lonp2 UTSW 8 86713373 missense probably damaging 1.00
R6236:Lonp2 UTSW 8 86636587 nonsense probably null
R6534:Lonp2 UTSW 8 86716458 missense probably benign 0.00
R6805:Lonp2 UTSW 8 86709096 missense probably benign
R6983:Lonp2 UTSW 8 86624248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTCTAGTTAGAGCATGTCC -3'
(R):5'- TCAAAAGCATGTGAGATCGTCTC -3'

Sequencing Primer
(F):5'- TAGAGCATGTCCTTCTGGAAAG -3'
(R):5'- TCCTACACTCAAGGGATTAGCTTAC -3'
Posted On2018-05-21