Incidental Mutation 'R6481:Slc9a5'
ID517113
Institutional Source Beutler Lab
Gene Symbol Slc9a5
Ensembl Gene ENSMUSG00000014786
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 5
SynonymsLOC277973
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R6481 (G1)
Quality Score175.009
Status Validated
Chromosome8
Chromosomal Location105348843-105369881 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 105358393 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 509 (K509*)
Ref Sequence ENSEMBL: ENSMUSP00000072893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073149]
Predicted Effect probably null
Transcript: ENSMUST00000073149
AA Change: K509*
SMART Domains Protein: ENSMUSP00000072893
Gene: ENSMUSG00000014786
AA Change: K509*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 39 N/A INTRINSIC
Pfam:Na_H_Exchanger 53 458 9.8e-89 PFAM
low complexity region 705 723 N/A INTRINSIC
low complexity region 807 823 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212772
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428L18Rik T C 1: 31,222,507 probably benign Het
5430419D17Rik A T 7: 131,256,801 D1066V probably benign Het
6430573F11Rik T C 8: 36,498,483 probably null Het
Abca9 G A 11: 110,165,962 Q11* probably null Het
Abcc9 A T 6: 142,604,895 M1273K probably damaging Het
Abi2 A G 1: 60,438,939 probably null Het
Acsm5 A G 7: 119,534,881 E295G probably benign Het
Anapc5 T C 5: 122,800,544 D389G probably benign Het
Ano3 A T 2: 110,795,027 D159E probably benign Het
Arhgap26 T A 18: 39,150,057 M349K probably damaging Het
Arhgef39 A G 4: 43,498,580 probably null Het
Astn1 T C 1: 158,612,462 S867P probably benign Het
Atad3a A T 4: 155,753,641 probably null Het
Cadm1 A T 9: 47,788,109 D91V probably damaging Het
Cc2d2b T C 19: 40,802,395 I933T possibly damaging Het
Celsr3 C G 9: 108,837,084 N1937K possibly damaging Het
Cic A C 7: 25,288,281 T558P possibly damaging Het
Cntln A G 4: 85,067,510 M933V probably benign Het
Coch T C 12: 51,598,173 F170S probably damaging Het
Col1a2 A G 6: 4,538,680 Y1200C unknown Het
Col26a1 T C 5: 136,744,178 M383V probably benign Het
Col4a4 A T 1: 82,453,778 M1595K unknown Het
Crh T C 3: 19,694,337 E47G probably benign Het
Cyhr1 T C 15: 76,658,708 probably null Het
D930020B18Rik T C 10: 121,661,148 probably null Het
Def6 G A 17: 28,226,163 R482H probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpagt1 T C 9: 44,331,190 L241P probably damaging Het
E2f7 A G 10: 110,774,681 E389G probably damaging Het
Eif2b1 T C 5: 124,577,111 I53V probably benign Het
Fbxo4 A G 15: 3,965,734 L376P probably damaging Het
Fgfr2 A G 7: 130,185,278 S352P possibly damaging Het
Fkbpl C A 17: 34,645,414 P52Q possibly damaging Het
Fry G A 5: 150,386,014 R641H probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm12728 A G 4: 105,794,349 K52R probably damaging Het
Gm8298 T C 3: 59,861,057 Y3H probably benign Het
Gtf2a1l A G 17: 88,711,625 D379G probably benign Het
Gys1 A T 7: 45,442,969 Y332F possibly damaging Het
Hoxa7 T A 6: 52,216,614 probably benign Het
Ifitm1 G A 7: 140,969,606 V101I probably benign Het
Kalrn T A 16: 34,360,984 T95S probably damaging Het
Leng8 A G 7: 4,145,413 Y728C probably damaging Het
Lonp2 G T 8: 86,634,908 D238Y possibly damaging Het
Ltn1 A C 16: 87,378,980 S1757A probably damaging Het
Man2a2 A T 7: 80,364,071 S411T probably damaging Het
Mrps33 C A 6: 39,805,370 probably null Het
Muc16 C T 9: 18,550,677 probably null Het
Muc5ac A G 7: 141,809,071 probably benign Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Olfr1141 T C 2: 87,753,468 N175S probably damaging Het
Olfr1204 A T 2: 88,852,519 T190S probably damaging Het
Olfr122 T G 17: 37,772,303 F217V probably damaging Het
Olfr1340 A G 4: 118,726,733 Y162C probably damaging Het
Olfr50 T A 2: 36,793,777 D180E possibly damaging Het
Olfr545 A T 7: 102,494,139 V212D probably damaging Het
Pag1 T A 3: 9,699,336 E252D possibly damaging Het
Plcd3 T C 11: 103,077,767 Y366C probably damaging Het
Psg17 A C 7: 18,814,450 S465R probably damaging Het
Ptpn9 G T 9: 57,023,040 V50L probably damaging Het
Rab17 T G 1: 90,958,961 S190R probably benign Het
Samd11 A G 4: 156,249,078 probably null Het
Slc17a5 A G 9: 78,538,271 F434S possibly damaging Het
Slc22a15 A G 3: 101,883,583 I202T possibly damaging Het
Slc8a1 G T 17: 81,388,918 Q896K probably benign Het
Slf2 A C 19: 44,973,164 M1041L probably benign Het
Smn1 A G 13: 100,128,500 probably null Het
Snx9 T C 17: 5,922,209 probably null Het
Soat2 T A 15: 102,162,055 L431Q probably damaging Het
Spam1 T A 6: 24,796,930 N293K probably benign Het
Tatdn1 T C 15: 58,923,911 T66A possibly damaging Het
Tmprss11g A T 5: 86,492,156 S205T probably benign Het
Tnpo3 G T 6: 29,571,101 N431K possibly damaging Het
Trim39 T C 17: 36,268,662 T31A probably benign Het
Tshz3 A G 7: 36,752,339 probably null Het
Ttll11 G A 2: 35,902,754 T359M probably damaging Het
Ttn T G 2: 76,741,499 D26350A probably damaging Het
Ubr4 G T 4: 139,431,751 V2472F probably damaging Het
Vsx2 C T 12: 84,593,104 P265S probably benign Het
Wdr90 C T 17: 25,845,911 G1708R probably damaging Het
Wnt11 A G 7: 98,853,274 Y351C probably damaging Het
Xpo6 A C 7: 126,112,885 N3K probably damaging Het
Zfp445 A G 9: 122,857,566 S165P probably benign Het
Zfp953 A T 13: 67,347,937 Y13* probably null Het
Other mutations in Slc9a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Slc9a5 APN 8 105349443 missense probably damaging 0.99
IGL02339:Slc9a5 APN 8 105358459 missense probably damaging 1.00
IGL03220:Slc9a5 APN 8 105368020 missense probably benign 0.09
P0026:Slc9a5 UTSW 8 105355291 missense probably damaging 1.00
R0680:Slc9a5 UTSW 8 105355907 missense probably null 1.00
R0990:Slc9a5 UTSW 8 105359446 missense probably damaging 1.00
R1440:Slc9a5 UTSW 8 105355153 missense possibly damaging 0.91
R1625:Slc9a5 UTSW 8 105368123 missense possibly damaging 0.88
R1737:Slc9a5 UTSW 8 105368134 missense probably damaging 1.00
R4169:Slc9a5 UTSW 8 105357400 missense possibly damaging 0.77
R4209:Slc9a5 UTSW 8 105358471 missense possibly damaging 0.89
R4210:Slc9a5 UTSW 8 105358471 missense possibly damaging 0.89
R4211:Slc9a5 UTSW 8 105358471 missense possibly damaging 0.89
R4345:Slc9a5 UTSW 8 105349455 missense probably benign
R4665:Slc9a5 UTSW 8 105368128 missense probably damaging 1.00
R5058:Slc9a5 UTSW 8 105355858 missense probably benign 0.03
R5553:Slc9a5 UTSW 8 105357040 missense probably damaging 1.00
R5574:Slc9a5 UTSW 8 105364691 missense probably benign 0.12
R5631:Slc9a5 UTSW 8 105349509 missense possibly damaging 0.73
R5645:Slc9a5 UTSW 8 105357013 missense probably benign 0.00
R5856:Slc9a5 UTSW 8 105357165 missense possibly damaging 0.58
R5907:Slc9a5 UTSW 8 105357175 critical splice donor site probably null
R6799:Slc9a5 UTSW 8 105363968 missense possibly damaging 0.84
R6834:Slc9a5 UTSW 8 105364684 missense probably benign 0.00
R6938:Slc9a5 UTSW 8 105353432 missense probably damaging 1.00
R7064:Slc9a5 UTSW 8 105349446 missense possibly damaging 0.91
R7095:Slc9a5 UTSW 8 105357636 missense probably benign 0.16
R7152:Slc9a5 UTSW 8 105368393 missense probably benign 0.03
R7303:Slc9a5 UTSW 8 105356713 missense probably damaging 0.99
X0058:Slc9a5 UTSW 8 105355305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAACTGTAAAGGCTGTAAGAAC -3'
(R):5'- TTGCTAACAAGCCTGCCTG -3'

Sequencing Primer
(F):5'- ACAGGGACTAGCCTTGAGATTCTC -3'
(R):5'- TAACAAGCCTGCCTGCCTGTC -3'
Posted On2018-05-21