Incidental Mutation 'R6481:Abca9'
ID517124
Institutional Source Beutler Lab
Gene Symbol Abca9
Ensembl Gene ENSMUSG00000041797
Gene NameATP-binding cassette, sub-family A (ABC1), member 9
SynonymsD630040K07Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_147220.2; MGI: 2386796

Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R6481 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location110100749-110168196 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 110165962 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 11 (Q11*)
Ref Sequence ENSEMBL: ENSMUSP00000036338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044850]
Predicted Effect probably null
Transcript: ENSMUST00000044850
AA Change: Q11*
SMART Domains Protein: ENSMUSP00000036338
Gene: ENSMUSG00000041797
AA Change: Q11*

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 419 2.7e-31 PFAM
AAA 509 693 9.28e-12 SMART
low complexity region 817 837 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Pfam:ABC2_membrane_3 918 1219 5.2e-15 PFAM
low complexity region 1250 1259 N/A INTRINSIC
AAA 1317 1497 8.47e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126499
Meta Mutation Damage Score 0.614 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two transmembrane domains and two nucleotide binding folds. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This gene is a member of the ABC1 subfamily and is clustered with four other ABC1 family members on chromosome 17q24. Transcriptional expression of this gene is induced during monocyte differentiation into macrophages and is suppressed by cholesterol import. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted(1

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428L18Rik T C 1: 31,222,507 probably benign Het
5430419D17Rik A T 7: 131,256,801 D1066V probably benign Het
6430573F11Rik T C 8: 36,498,483 probably null Het
Abcc9 A T 6: 142,604,895 M1273K probably damaging Het
Abi2 A G 1: 60,438,939 probably null Het
Acsm5 A G 7: 119,534,881 E295G probably benign Het
Anapc5 T C 5: 122,800,544 D389G probably benign Het
Ano3 A T 2: 110,795,027 D159E probably benign Het
Arhgap26 T A 18: 39,150,057 M349K probably damaging Het
Arhgef39 A G 4: 43,498,580 probably null Het
Astn1 T C 1: 158,612,462 S867P probably benign Het
Atad3a A T 4: 155,753,641 probably null Het
Cadm1 A T 9: 47,788,109 D91V probably damaging Het
Cc2d2b T C 19: 40,802,395 I933T possibly damaging Het
Celsr3 C G 9: 108,837,084 N1937K possibly damaging Het
Cic A C 7: 25,288,281 T558P possibly damaging Het
Cntln A G 4: 85,067,510 M933V probably benign Het
Coch T C 12: 51,598,173 F170S probably damaging Het
Col1a2 A G 6: 4,538,680 Y1200C unknown Het
Col26a1 T C 5: 136,744,178 M383V probably benign Het
Col4a4 A T 1: 82,453,778 M1595K unknown Het
Crh T C 3: 19,694,337 E47G probably benign Het
Cyhr1 T C 15: 76,658,708 probably null Het
D930020B18Rik T C 10: 121,661,148 probably null Het
Def6 G A 17: 28,226,163 R482H probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpagt1 T C 9: 44,331,190 L241P probably damaging Het
E2f7 A G 10: 110,774,681 E389G probably damaging Het
Eif2b1 T C 5: 124,577,111 I53V probably benign Het
Fbxo4 A G 15: 3,965,734 L376P probably damaging Het
Fgfr2 A G 7: 130,185,278 S352P possibly damaging Het
Fkbpl C A 17: 34,645,414 P52Q possibly damaging Het
Fry G A 5: 150,386,014 R641H probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm12728 A G 4: 105,794,349 K52R probably damaging Het
Gm8298 T C 3: 59,861,057 Y3H probably benign Het
Gtf2a1l A G 17: 88,711,625 D379G probably benign Het
Gys1 A T 7: 45,442,969 Y332F possibly damaging Het
Hoxa7 T A 6: 52,216,614 probably benign Het
Ifitm1 G A 7: 140,969,606 V101I probably benign Het
Kalrn T A 16: 34,360,984 T95S probably damaging Het
Leng8 A G 7: 4,145,413 Y728C probably damaging Het
Lonp2 G T 8: 86,634,908 D238Y possibly damaging Het
Ltn1 A C 16: 87,378,980 S1757A probably damaging Het
Man2a2 A T 7: 80,364,071 S411T probably damaging Het
Mrps33 C A 6: 39,805,370 probably null Het
Muc16 C T 9: 18,550,677 probably null Het
Muc5ac A G 7: 141,809,071 probably benign Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Olfr1141 T C 2: 87,753,468 N175S probably damaging Het
Olfr1204 A T 2: 88,852,519 T190S probably damaging Het
Olfr122 T G 17: 37,772,303 F217V probably damaging Het
Olfr1340 A G 4: 118,726,733 Y162C probably damaging Het
Olfr50 T A 2: 36,793,777 D180E possibly damaging Het
Olfr545 A T 7: 102,494,139 V212D probably damaging Het
Pag1 T A 3: 9,699,336 E252D possibly damaging Het
Plcd3 T C 11: 103,077,767 Y366C probably damaging Het
Psg17 A C 7: 18,814,450 S465R probably damaging Het
Ptpn9 G T 9: 57,023,040 V50L probably damaging Het
Rab17 T G 1: 90,958,961 S190R probably benign Het
Samd11 A G 4: 156,249,078 probably null Het
Slc17a5 A G 9: 78,538,271 F434S possibly damaging Het
Slc22a15 A G 3: 101,883,583 I202T possibly damaging Het
Slc8a1 G T 17: 81,388,918 Q896K probably benign Het
Slc9a5 A T 8: 105,358,393 K509* probably null Het
Slf2 A C 19: 44,973,164 M1041L probably benign Het
Smn1 A G 13: 100,128,500 probably null Het
Snx9 T C 17: 5,922,209 probably null Het
Soat2 T A 15: 102,162,055 L431Q probably damaging Het
Spam1 T A 6: 24,796,930 N293K probably benign Het
Tatdn1 T C 15: 58,923,911 T66A possibly damaging Het
Tmprss11g A T 5: 86,492,156 S205T probably benign Het
Tnpo3 G T 6: 29,571,101 N431K possibly damaging Het
Trim39 T C 17: 36,268,662 T31A probably benign Het
Tshz3 A G 7: 36,752,339 probably null Het
Ttll11 G A 2: 35,902,754 T359M probably damaging Het
Ttn T G 2: 76,741,499 D26350A probably damaging Het
Ubr4 G T 4: 139,431,751 V2472F probably damaging Het
Vsx2 C T 12: 84,593,104 P265S probably benign Het
Wdr90 C T 17: 25,845,911 G1708R probably damaging Het
Wnt11 A G 7: 98,853,274 Y351C probably damaging Het
Xpo6 A C 7: 126,112,885 N3K probably damaging Het
Zfp445 A G 9: 122,857,566 S165P probably benign Het
Zfp953 A T 13: 67,347,937 Y13* probably null Het
Other mutations in Abca9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Abca9 APN 11 110160516 missense probably benign
IGL00467:Abca9 APN 11 110145670 splice site probably benign
IGL00886:Abca9 APN 11 110163275 missense possibly damaging 0.93
IGL01340:Abca9 APN 11 110130627 missense probably benign
IGL01351:Abca9 APN 11 110148903 missense probably damaging 0.99
IGL01383:Abca9 APN 11 110113293 splice site probably benign
IGL01384:Abca9 APN 11 110145637 missense probably damaging 1.00
IGL01482:Abca9 APN 11 110120773 missense probably benign 0.05
IGL01586:Abca9 APN 11 110154417 missense probably damaging 0.99
IGL01589:Abca9 APN 11 110155177 missense probably damaging 1.00
IGL01926:Abca9 APN 11 110135329 splice site probably benign
IGL02059:Abca9 APN 11 110160394 splice site probably benign
IGL02084:Abca9 APN 11 110130597 missense probably benign
IGL02096:Abca9 APN 11 110102533 missense probably damaging 1.00
IGL02096:Abca9 APN 11 110165980 missense probably benign 0.01
IGL02290:Abca9 APN 11 110135351 missense probably damaging 1.00
IGL02303:Abca9 APN 11 110154550 missense probably damaging 1.00
IGL02549:Abca9 APN 11 110102053 missense probably damaging 1.00
IGL02687:Abca9 APN 11 110114232 missense probably damaging 1.00
IGL02752:Abca9 APN 11 110127368 missense probably damaging 1.00
IGL02814:Abca9 APN 11 110154467 missense possibly damaging 0.90
IGL02878:Abca9 APN 11 110138329 missense probably benign 0.01
IGL03088:Abca9 APN 11 110144261 missense probably benign 0.06
IGL03231:Abca9 APN 11 110155268 missense probably damaging 0.96
R0050:Abca9 UTSW 11 110145591 missense probably damaging 1.00
R0050:Abca9 UTSW 11 110145591 missense probably damaging 1.00
R0064:Abca9 UTSW 11 110144871 missense probably damaging 1.00
R0064:Abca9 UTSW 11 110144872 missense probably damaging 1.00
R0068:Abca9 UTSW 11 110145579 missense probably damaging 0.99
R0189:Abca9 UTSW 11 110108653 missense probably damaging 1.00
R0189:Abca9 UTSW 11 110141662 splice site probably benign
R0375:Abca9 UTSW 11 110115447 missense probably benign 0.00
R0601:Abca9 UTSW 11 110117058 critical splice donor site probably null
R0624:Abca9 UTSW 11 110139620 missense probably damaging 1.00
R0652:Abca9 UTSW 11 110152063 missense probably benign 0.02
R1004:Abca9 UTSW 11 110151954 missense possibly damaging 0.88
R1222:Abca9 UTSW 11 110145064 splice site probably benign
R1451:Abca9 UTSW 11 110127447 missense probably damaging 1.00
R1462:Abca9 UTSW 11 110160516 missense probably benign
R1462:Abca9 UTSW 11 110160516 missense probably benign
R1474:Abca9 UTSW 11 110145579 missense probably damaging 0.99
R1499:Abca9 UTSW 11 110139632 missense probably benign 0.00
R1778:Abca9 UTSW 11 110130716 nonsense probably null
R2015:Abca9 UTSW 11 110131846 missense probably benign 0.01
R2295:Abca9 UTSW 11 110148903 missense probably damaging 0.99
R2303:Abca9 UTSW 11 110158226 missense probably benign 0.01
R2403:Abca9 UTSW 11 110115454 missense probably benign 0.16
R2886:Abca9 UTSW 11 110144886 splice site probably benign
R3435:Abca9 UTSW 11 110154430 missense probably benign 0.24
R3976:Abca9 UTSW 11 110148789 missense probably benign 0.25
R4335:Abca9 UTSW 11 110152017 missense probably damaging 1.00
R4411:Abca9 UTSW 11 110151955 missense probably benign 0.00
R4613:Abca9 UTSW 11 110144784 missense probably benign 0.26
R4690:Abca9 UTSW 11 110148880 missense probably damaging 1.00
R4720:Abca9 UTSW 11 110127422 missense probably damaging 1.00
R4751:Abca9 UTSW 11 110130570 missense probably benign 0.00
R4797:Abca9 UTSW 11 110118119 missense probably benign
R4818:Abca9 UTSW 11 110155154 critical splice donor site probably null
R4903:Abca9 UTSW 11 110147001 missense probably damaging 1.00
R4971:Abca9 UTSW 11 110152048 missense probably benign 0.43
R4977:Abca9 UTSW 11 110136073 missense probably benign 0.00
R5019:Abca9 UTSW 11 110165934 missense probably benign
R5079:Abca9 UTSW 11 110145569 missense possibly damaging 0.47
R5082:Abca9 UTSW 11 110131868 missense probably benign
R5093:Abca9 UTSW 11 110141532 missense probably damaging 0.98
R5212:Abca9 UTSW 11 110107226 missense probably benign 0.02
R5350:Abca9 UTSW 11 110115538 missense probably benign
R5368:Abca9 UTSW 11 110145546 missense probably damaging 1.00
R5432:Abca9 UTSW 11 110141554 missense possibly damaging 0.83
R5436:Abca9 UTSW 11 110134236 missense probably damaging 1.00
R5497:Abca9 UTSW 11 110130692 missense probably damaging 1.00
R5503:Abca9 UTSW 11 110141610 missense probably damaging 1.00
R5594:Abca9 UTSW 11 110144862 missense probably damaging 1.00
R5742:Abca9 UTSW 11 110160417 missense probably damaging 0.98
R5776:Abca9 UTSW 11 110107460 splice site probably null
R5781:Abca9 UTSW 11 110101987 missense probably damaging 1.00
R5872:Abca9 UTSW 11 110117076 missense possibly damaging 0.70
R5923:Abca9 UTSW 11 110160552 missense probably benign 0.09
R6020:Abca9 UTSW 11 110145613 missense possibly damaging 0.86
R6179:Abca9 UTSW 11 110134254 missense probably benign 0.05
R6245:Abca9 UTSW 11 110135423 missense probably damaging 1.00
R6249:Abca9 UTSW 11 110145627 missense probably benign
R6365:Abca9 UTSW 11 110145655 missense possibly damaging 0.63
R6385:Abca9 UTSW 11 110134254 missense probably damaging 0.99
R6675:Abca9 UTSW 11 110115476 missense probably benign
R6909:Abca9 UTSW 11 110115497 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCCCAGGACTTGAAAAGTTC -3'
(R):5'- TCCGAGAAGTCACTCCATAGAAG -3'

Sequencing Primer
(F):5'- CAAGCCTGTTAGTTATATCTGTGGC -3'
(R):5'- GTCACTCCATAGAAGAAAAGACTCTC -3'
Posted On2018-05-21