Incidental Mutation 'R6481:Coch'
ID517125
Institutional Source Beutler Lab
Gene Symbol Coch
Ensembl Gene ENSMUSG00000020953
Gene Namecochlin
SynonymsCoch-5B2, D12H14S564E
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6481 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location51593341-51605771 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51598173 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 170 (F170S)
Ref Sequence ENSEMBL: ENSMUSP00000128127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085412] [ENSMUST00000164782]
Predicted Effect probably damaging
Transcript: ENSMUST00000085412
AA Change: F170S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082533
Gene: ENSMUSG00000020953
AA Change: F170S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164782
AA Change: F170S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128127
Gene: ENSMUSG00000020953
AA Change: F170S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 32 114 3.64e-47 SMART
VWA 165 337 2.06e-33 SMART
VWA 367 540 6.43e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220173
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly conserved in human, mouse, and chicken, showing 94% and 79% amino acid identity of human to mouse and chicken sequences, respectively. Hybridization to this gene was detected in spindle-shaped cells located along nerve fibers between the auditory ganglion and sensory epithelium. These cells accompany neurites at the habenula perforata, the opening through which neurites extend to innervate hair cells. This and the pattern of expression of this gene in chicken inner ear paralleled the histologic findings of acidophilic deposits, consistent with mucopolysaccharide ground substance, in temporal bones from DFNA9 (autosomal dominant nonsyndromic sensorineural deafness 9) patients. Mutations that cause DFNA9 have been reported in this gene. Alternative splicing results in multiple transcript variants encoding the same protein. Additional splice variants encoding distinct isoforms have been described but their biological validities have not been demonstrated. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a point mutation have vestibular and hearing dysfunctions that worsen with age. Homozyogtes for a null allele have no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428L18Rik T C 1: 31,222,507 probably benign Het
5430419D17Rik A T 7: 131,256,801 D1066V probably benign Het
6430573F11Rik T C 8: 36,498,483 probably null Het
Abca9 G A 11: 110,165,962 Q11* probably null Het
Abcc9 A T 6: 142,604,895 M1273K probably damaging Het
Abi2 A G 1: 60,438,939 probably null Het
Acsm5 A G 7: 119,534,881 E295G probably benign Het
Anapc5 T C 5: 122,800,544 D389G probably benign Het
Ano3 A T 2: 110,795,027 D159E probably benign Het
Arhgap26 T A 18: 39,150,057 M349K probably damaging Het
Arhgef39 A G 4: 43,498,580 probably null Het
Astn1 T C 1: 158,612,462 S867P probably benign Het
Atad3a A T 4: 155,753,641 probably null Het
Cadm1 A T 9: 47,788,109 D91V probably damaging Het
Cc2d2b T C 19: 40,802,395 I933T possibly damaging Het
Celsr3 C G 9: 108,837,084 N1937K possibly damaging Het
Cic A C 7: 25,288,281 T558P possibly damaging Het
Cntln A G 4: 85,067,510 M933V probably benign Het
Col1a2 A G 6: 4,538,680 Y1200C unknown Het
Col26a1 T C 5: 136,744,178 M383V probably benign Het
Col4a4 A T 1: 82,453,778 M1595K unknown Het
Crh T C 3: 19,694,337 E47G probably benign Het
Cyhr1 T C 15: 76,658,708 probably null Het
D930020B18Rik T C 10: 121,661,148 probably null Het
Def6 G A 17: 28,226,163 R482H probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpagt1 T C 9: 44,331,190 L241P probably damaging Het
E2f7 A G 10: 110,774,681 E389G probably damaging Het
Eif2b1 T C 5: 124,577,111 I53V probably benign Het
Fbxo4 A G 15: 3,965,734 L376P probably damaging Het
Fgfr2 A G 7: 130,185,278 S352P possibly damaging Het
Fkbpl C A 17: 34,645,414 P52Q possibly damaging Het
Fry G A 5: 150,386,014 R641H probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm12728 A G 4: 105,794,349 K52R probably damaging Het
Gm8298 T C 3: 59,861,057 Y3H probably benign Het
Gtf2a1l A G 17: 88,711,625 D379G probably benign Het
Gys1 A T 7: 45,442,969 Y332F possibly damaging Het
Hoxa7 T A 6: 52,216,614 probably benign Het
Ifitm1 G A 7: 140,969,606 V101I probably benign Het
Kalrn T A 16: 34,360,984 T95S probably damaging Het
Leng8 A G 7: 4,145,413 Y728C probably damaging Het
Lonp2 G T 8: 86,634,908 D238Y possibly damaging Het
Ltn1 A C 16: 87,378,980 S1757A probably damaging Het
Man2a2 A T 7: 80,364,071 S411T probably damaging Het
Mrps33 C A 6: 39,805,370 probably null Het
Muc16 C T 9: 18,550,677 probably null Het
Muc5ac A G 7: 141,809,071 probably benign Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Olfr1141 T C 2: 87,753,468 N175S probably damaging Het
Olfr1204 A T 2: 88,852,519 T190S probably damaging Het
Olfr122 T G 17: 37,772,303 F217V probably damaging Het
Olfr1340 A G 4: 118,726,733 Y162C probably damaging Het
Olfr50 T A 2: 36,793,777 D180E possibly damaging Het
Olfr545 A T 7: 102,494,139 V212D probably damaging Het
Pag1 T A 3: 9,699,336 E252D possibly damaging Het
Plcd3 T C 11: 103,077,767 Y366C probably damaging Het
Psg17 A C 7: 18,814,450 S465R probably damaging Het
Ptpn9 G T 9: 57,023,040 V50L probably damaging Het
Rab17 T G 1: 90,958,961 S190R probably benign Het
Samd11 A G 4: 156,249,078 probably null Het
Slc17a5 A G 9: 78,538,271 F434S possibly damaging Het
Slc22a15 A G 3: 101,883,583 I202T possibly damaging Het
Slc8a1 G T 17: 81,388,918 Q896K probably benign Het
Slc9a5 A T 8: 105,358,393 K509* probably null Het
Slf2 A C 19: 44,973,164 M1041L probably benign Het
Smn1 A G 13: 100,128,500 probably null Het
Snx9 T C 17: 5,922,209 probably null Het
Soat2 T A 15: 102,162,055 L431Q probably damaging Het
Spam1 T A 6: 24,796,930 N293K probably benign Het
Tatdn1 T C 15: 58,923,911 T66A possibly damaging Het
Tmprss11g A T 5: 86,492,156 S205T probably benign Het
Tnpo3 G T 6: 29,571,101 N431K possibly damaging Het
Trim39 T C 17: 36,268,662 T31A probably benign Het
Tshz3 A G 7: 36,752,339 probably null Het
Ttll11 G A 2: 35,902,754 T359M probably damaging Het
Ttn T G 2: 76,741,499 D26350A probably damaging Het
Ubr4 G T 4: 139,431,751 V2472F probably damaging Het
Vsx2 C T 12: 84,593,104 P265S probably benign Het
Wdr90 C T 17: 25,845,911 G1708R probably damaging Het
Wnt11 A G 7: 98,853,274 Y351C probably damaging Het
Xpo6 A C 7: 126,112,885 N3K probably damaging Het
Zfp445 A G 9: 122,857,566 S165P probably benign Het
Zfp953 A T 13: 67,347,937 Y13* probably null Het
Other mutations in Coch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Coch APN 12 51603353 missense probably damaging 1.00
IGL01803:Coch APN 12 51603299 missense probably benign 0.15
IGL02613:Coch APN 12 51595349 missense possibly damaging 0.76
IGL02697:Coch APN 12 51597038 missense probably benign 0.00
IGL03351:Coch APN 12 51603206 missense probably benign 0.05
R0732:Coch UTSW 12 51595372 missense probably damaging 1.00
R1485:Coch UTSW 12 51598289 missense probably damaging 1.00
R1757:Coch UTSW 12 51602848 missense probably damaging 1.00
R2073:Coch UTSW 12 51602689 missense probably benign 0.00
R2231:Coch UTSW 12 51602865 missense probably benign
R2440:Coch UTSW 12 51596562 missense probably damaging 0.99
R3104:Coch UTSW 12 51603421 missense probably benign
R3623:Coch UTSW 12 51602826 missense probably benign 0.06
R3624:Coch UTSW 12 51602826 missense probably benign 0.06
R3932:Coch UTSW 12 51603338 missense probably damaging 1.00
R3933:Coch UTSW 12 51603338 missense probably damaging 1.00
R3945:Coch UTSW 12 51601812 critical splice acceptor site probably null
R3946:Coch UTSW 12 51601812 critical splice acceptor site probably null
R4423:Coch UTSW 12 51598149 splice site probably null
R4660:Coch UTSW 12 51595485 missense probably benign 0.21
R4732:Coch UTSW 12 51605019 missense probably benign 0.28
R4733:Coch UTSW 12 51605019 missense probably benign 0.28
R4844:Coch UTSW 12 51602694 missense probably damaging 0.98
R4997:Coch UTSW 12 51603181 splice site probably null
R5152:Coch UTSW 12 51595442 missense probably benign 0.00
R5173:Coch UTSW 12 51596507 nonsense probably null
R6134:Coch UTSW 12 51602753 missense probably damaging 1.00
R6497:Coch UTSW 12 51602721 missense probably benign 0.06
R6714:Coch UTSW 12 51602737 missense probably damaging 1.00
R6896:Coch UTSW 12 51602869 missense possibly damaging 0.62
R7242:Coch UTSW 12 51593561 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGTTGCCAAGAGCTTCCTTC -3'
(R):5'- GTTTGGATTACAGCTTGTCCAG -3'

Sequencing Primer
(F):5'- GCCAAGAGCTTCCTTCTTTTCAGG -3'
(R):5'- GGATTACAGCTTGTCCAGATTTAAG -3'
Posted On2018-05-21