Mutagenetix > Incidental Mutation

Incidental Mutation 'R6481:Kalrn'

517133

Institutional Source

Beutler Lab

Gene Symbol

Kalrn

Ensembl Gene

ENSMUSG00000061751

Gene Name

kalirin, RhoGEF kinase

Synonyms

E530005C20Rik, LOC224126, Hapip, 2210407G14Rik

MMRRC Submission

044613-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.918) question?

Stock #

R6481 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33789443-34393647 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34181354 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 95 (T95S)

Ref Sequence

ENSEMBL: ENSMUSP00000087084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114960] [ENSMUST00000114961] [ENSMUST00000151491]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000076810
AA Change: T77S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: T77S

Domain	Start	End	E-Value	Type
SEC14	20	159	2.22e-30	SMART
SPEC	173	289	5.32e-9	SMART
SPEC	295	397	1.19e-11	SMART
SPEC	400	515	1.83e0	SMART
SPEC	521	623	9.84e-13	SMART
SPEC	626	748	2.74e-2	SMART
SPEC	875	976	8.11e-14	SMART
SPEC	1106	1208	4.7e-10	SMART
RhoGEF	1258	1428	3.6e-56	SMART
PH	1442	1555	5.24e-8	SMART
SH3	1622	1683	1.23e-7	SMART
RhoGEF	1904	2074	1.47e-52	SMART
PH	2094	2199	9.87e-4	SMART
SH3	2295	2356	2.78e-2	SMART
IGc2	2455	2527	4.28e-12	SMART
FN3	2541	2623	3.07e-11	SMART
S_TKc	2656	2910	1.28e-71	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000089655
AA Change: T95S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: T95S

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	1003	1.85e-8	SMART
SPEC	1133	1235	4.7e-10	SMART
RhoGEF	1285	1455	3.6e-56	SMART
PH	1469	1582	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114960
AA Change: T95S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: T95S

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	994	8.11e-14	SMART
SPEC	1124	1226	4.7e-10	SMART
RhoGEF	1276	1446	3.6e-56	SMART
PH	1460	1573	5.24e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114961

SMART Domains

Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SEC14	40	179	2.22e-30	SMART
SPEC	193	309	5.32e-9	SMART
SPEC	315	417	1.19e-11	SMART
SPEC	420	535	1.83e0	SMART
SPEC	541	643	9.84e-13	SMART
SPEC	646	768	2.74e-2	SMART
SPEC	895	996	8.11e-14	SMART
SPEC	1126	1228	4.7e-10	SMART
RhoGEF	1278	1448	3.6e-56	SMART
PH	1462	1575	5.24e-8	SMART
SH3	1642	1703	1.23e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000142817
AA Change: T72S

SMART Domains

Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: T72S

Domain	Start	End	E-Value	Type
SEC14	16	155	2.22e-30	SMART
SPEC	169	285	5.32e-9	SMART
SPEC	291	393	1.19e-11	SMART
SPEC	396	511	1.83e0	SMART
SPEC	517	619	9.84e-13	SMART
SPEC	622	744	2.74e-2	SMART
SPEC	871	972	8.11e-14	SMART
SPEC	1102	1204	4.7e-10	SMART
RhoGEF	1254	1424	3.6e-56	SMART
PH	1438	1551	5.24e-8	SMART
SH3	1618	1679	1.23e-7	SMART
RhoGEF	1900	2070	1.47e-52	SMART
PH	2090	2195	9.87e-4	SMART
SH3	2291	2352	2.78e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000151491
AA Change: T83S

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751
AA Change: T83S

Domain	Start	End	E-Value	Type
SEC14	26	165	2.22e-30	SMART
SPEC	179	295	5.32e-9	SMART
SPEC	301	403	1.19e-11	SMART
SPEC	640	750	1.85e-8	SMART
SPEC	880	982	4.7e-10	SMART
RhoGEF	1032	1202	3.6e-56	SMART
PH	1216	1329	5.24e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156668

Meta Mutation Damage Score

0.0683

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931428L18Rik	T	C	1: 31,261,588 (GRCm39)		probably benign	Het
Aadacl2fm3	T	C	3: 59,768,478 (GRCm39)	Y3H	probably benign	Het
Abca9	G	A	11: 110,056,788 (GRCm39)	Q11*	probably null	Het
Abcc9	A	T	6: 142,550,621 (GRCm39)	M1273K	probably damaging	Het
Abi2	A	G	1: 60,478,098 (GRCm39)		probably null	Het
Acsm5	A	G	7: 119,134,104 (GRCm39)	E295G	probably benign	Het
Anapc5	T	C	5: 122,938,607 (GRCm39)	D389G	probably benign	Het
Ano3	A	T	2: 110,625,372 (GRCm39)	D159E	probably benign	Het
Arhgap26	T	A	18: 39,283,110 (GRCm39)	M349K	probably damaging	Het
Arhgef39	A	G	4: 43,498,580 (GRCm39)		probably null	Het
Astn1	T	C	1: 158,440,032 (GRCm39)	S867P	probably benign	Het
Atad3a	A	T	4: 155,838,098 (GRCm39)		probably null	Het
Cadm1	A	T	9: 47,699,407 (GRCm39)	D91V	probably damaging	Het
Cc2d2b	T	C	19: 40,790,839 (GRCm39)	I933T	possibly damaging	Het
Cdcp3	A	T	7: 130,858,530 (GRCm39)	D1066V	probably benign	Het
Celsr3	C	G	9: 108,714,283 (GRCm39)	N1937K	possibly damaging	Het
Cic	A	C	7: 24,987,706 (GRCm39)	T558P	possibly damaging	Het
Cntln	A	G	4: 84,985,747 (GRCm39)	M933V	probably benign	Het
Coch	T	C	12: 51,644,956 (GRCm39)	F170S	probably damaging	Het
Col1a2	A	G	6: 4,538,680 (GRCm39)	Y1200C	unknown	Het
Col26a1	T	C	5: 136,773,032 (GRCm39)	M383V	probably benign	Het
Col4a4	A	T	1: 82,431,499 (GRCm39)	M1595K	unknown	Het
Crh	T	C	3: 19,748,501 (GRCm39)	E47G	probably benign	Het
D930020B18Rik	T	C	10: 121,497,053 (GRCm39)		probably null	Het
Def6	G	A	17: 28,445,137 (GRCm39)	R482H	probably benign	Het
Dnah8	G	A	17: 30,967,542 (GRCm39)	D2585N	probably benign	Het
Dpagt1	T	C	9: 44,242,487 (GRCm39)	L241P	probably damaging	Het
E2f7	A	G	10: 110,610,542 (GRCm39)	E389G	probably damaging	Het
Eif2b1	T	C	5: 124,715,174 (GRCm39)	I53V	probably benign	Het
Fbxo4	A	G	15: 3,995,216 (GRCm39)	L376P	probably damaging	Het
Fgfr2	A	G	7: 129,787,008 (GRCm39)	S352P	possibly damaging	Het
Fkbpl	C	A	17: 34,864,388 (GRCm39)	P52Q	possibly damaging	Het
Fry	G	A	5: 150,309,479 (GRCm39)	R641H	probably damaging	Het
Fsip2	A	G	2: 82,820,430 (GRCm39)	T5388A	possibly damaging	Het
Gm12728	A	G	4: 105,651,546 (GRCm39)	K52R	probably damaging	Het
Gtf2a1l	A	G	17: 89,019,053 (GRCm39)	D379G	probably benign	Het
Gys1	A	T	7: 45,092,393 (GRCm39)	Y332F	possibly damaging	Het
Hoxa7	T	A	6: 52,193,594 (GRCm39)		probably benign	Het
Ifitm1	G	A	7: 140,549,519 (GRCm39)	V101I	probably benign	Het
Leng8	A	G	7: 4,148,412 (GRCm39)	Y728C	probably damaging	Het
Lonp2	G	T	8: 87,361,536 (GRCm39)	D238Y	possibly damaging	Het
Ltn1	A	C	16: 87,175,868 (GRCm39)	S1757A	probably damaging	Het
Man2a2	A	T	7: 80,013,819 (GRCm39)	S411T	probably damaging	Het
Mrps33	C	A	6: 39,782,304 (GRCm39)		probably null	Het
Muc16	C	T	9: 18,461,973 (GRCm39)		probably null	Het
Muc5ac	A	G	7: 141,362,808 (GRCm39)		probably benign	Het
Naip2	A	C	13: 100,298,549 (GRCm39)	S496A	probably benign	Het
Or10al6	T	G	17: 38,083,194 (GRCm39)	F217V	probably damaging	Het
Or13p8	A	G	4: 118,583,930 (GRCm39)	Y162C	probably damaging	Het
Or1j21	T	A	2: 36,683,789 (GRCm39)	D180E	possibly damaging	Het
Or4c106	A	T	2: 88,682,863 (GRCm39)	T190S	probably damaging	Het
Or55b10	A	T	7: 102,143,346 (GRCm39)	V212D	probably damaging	Het
Or5w17	T	C	2: 87,583,812 (GRCm39)	N175S	probably damaging	Het
Pag1	T	A	3: 9,764,396 (GRCm39)	E252D	possibly damaging	Het
Plcd3	T	C	11: 102,968,593 (GRCm39)	Y366C	probably damaging	Het
Psg17	A	C	7: 18,548,375 (GRCm39)	S465R	probably damaging	Het
Ptpn9	G	T	9: 56,930,324 (GRCm39)	V50L	probably damaging	Het
Rab17	T	G	1: 90,886,683 (GRCm39)	S190R	probably benign	Het
Samd11	A	G	4: 156,333,535 (GRCm39)		probably null	Het
Slc17a5	A	G	9: 78,445,553 (GRCm39)	F434S	possibly damaging	Het
Slc22a15	A	G	3: 101,790,899 (GRCm39)	I202T	possibly damaging	Het
Slc8a1	G	T	17: 81,696,347 (GRCm39)	Q896K	probably benign	Het
Slc9a5	A	T	8: 106,085,025 (GRCm39)	K509*	probably null	Het
Slf2	A	C	19: 44,961,603 (GRCm39)	M1041L	probably benign	Het
Smn1	A	G	13: 100,265,008 (GRCm39)		probably null	Het
Snx9	T	C	17: 5,972,484 (GRCm39)		probably null	Het
Soat2	T	A	15: 102,070,490 (GRCm39)	L431Q	probably damaging	Het
Spam1	T	A	6: 24,796,929 (GRCm39)	N293K	probably benign	Het
Tatdn1	T	C	15: 58,795,760 (GRCm39)	T66A	possibly damaging	Het
Tmprss11g	A	T	5: 86,640,015 (GRCm39)	S205T	probably benign	Het
Tnpo3	G	T	6: 29,571,100 (GRCm39)	N431K	possibly damaging	Het
Trim39	T	C	17: 36,579,554 (GRCm39)	T31A	probably benign	Het
Trmt9b	T	C	8: 36,965,637 (GRCm39)		probably null	Het
Tshz3	A	G	7: 36,451,764 (GRCm39)		probably null	Het
Ttll11	G	A	2: 35,792,766 (GRCm39)	T359M	probably damaging	Het
Ttn	T	G	2: 76,571,843 (GRCm39)	D26350A	probably damaging	Het
Ubr4	G	T	4: 139,159,062 (GRCm39)	V2472F	probably damaging	Het
Vsx2	C	T	12: 84,639,878 (GRCm39)	P265S	probably benign	Het
Wdr90	C	T	17: 26,064,885 (GRCm39)	G1708R	probably damaging	Het
Wnt11	A	G	7: 98,502,481 (GRCm39)	Y351C	probably damaging	Het
Xpo6	A	C	7: 125,712,057 (GRCm39)	N3K	probably damaging	Het
Zfp445	A	G	9: 122,686,631 (GRCm39)	S165P	probably benign	Het
Zfp953	A	T	13: 67,496,001 (GRCm39)	Y13*	probably null	Het
Zftraf1	T	C	15: 76,542,908 (GRCm39)		probably null	Het

Other mutations in Kalrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Kalrn	APN	16	33,996,092 (GRCm39)	splice site	probably benign
IGL01364:Kalrn	APN	16	34,082,999 (GRCm39)	missense	probably damaging	1.00
IGL01510:Kalrn	APN	16	34,055,700 (GRCm39)	missense	possibly damaging	0.52
IGL01664:Kalrn	APN	16	34,114,531 (GRCm39)	missense	probably damaging	1.00
IGL01934:Kalrn	APN	16	34,018,882 (GRCm39)	splice site	probably null
IGL02059:Kalrn	APN	16	34,072,711 (GRCm39)	missense	possibly damaging	0.95
IGL02102:Kalrn	APN	16	34,040,592 (GRCm39)	missense	probably damaging	1.00
IGL02306:Kalrn	APN	16	34,130,897 (GRCm39)	missense	probably damaging	0.97
IGL02328:Kalrn	APN	16	34,152,594 (GRCm39)	missense	probably damaging	0.98
IGL02532:Kalrn	APN	16	34,181,216 (GRCm39)	missense	probably damaging	1.00
IGL02685:Kalrn	APN	16	34,334,329 (GRCm39)	nonsense	probably null
IGL02696:Kalrn	APN	16	34,040,484 (GRCm39)	missense	probably damaging	1.00
IGL02708:Kalrn	APN	16	34,212,420 (GRCm39)	missense	probably damaging	1.00
IGL02937:Kalrn	APN	16	34,040,500 (GRCm39)	nonsense	probably null
IGL03188:Kalrn	APN	16	34,134,562 (GRCm39)	missense	probably benign	0.01
IGL03289:Kalrn	APN	16	34,205,667 (GRCm39)	missense	possibly damaging	0.90
IGL03408:Kalrn	APN	16	34,134,546 (GRCm39)	missense	probably damaging	0.99
breeze	UTSW	16	33,834,045 (GRCm39)	missense
ethereal	UTSW	16	33,795,805 (GRCm39)	utr 3 prime	probably benign
Feather	UTSW	16	34,134,579 (GRCm39)	missense	probably damaging	0.99
Hidden	UTSW	16	33,848,346 (GRCm39)	missense	probably damaging	1.00
Soulful	UTSW	16	34,007,854 (GRCm39)	nonsense	probably null
G1Funyon:Kalrn	UTSW	16	34,177,470 (GRCm39)	missense	probably benign	0.05
PIT4498001:Kalrn	UTSW	16	33,851,952 (GRCm39)	missense	possibly damaging	0.81
R0019:Kalrn	UTSW	16	34,018,884 (GRCm39)	splice site	probably benign
R0043:Kalrn	UTSW	16	33,875,276 (GRCm39)	missense	probably damaging	1.00
R0052:Kalrn	UTSW	16	34,177,541 (GRCm39)	missense	probably damaging	1.00
R0066:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R0098:Kalrn	UTSW	16	33,795,989 (GRCm39)	missense	possibly damaging	0.89
R0098:Kalrn	UTSW	16	33,795,989 (GRCm39)	missense	possibly damaging	0.89
R0111:Kalrn	UTSW	16	33,851,960 (GRCm39)	missense	probably damaging	1.00
R0113:Kalrn	UTSW	16	33,870,306 (GRCm39)	intron	probably benign
R0183:Kalrn	UTSW	16	33,991,749 (GRCm39)	splice site	probably null
R0422:Kalrn	UTSW	16	34,134,643 (GRCm39)	missense	probably damaging	0.99
R0498:Kalrn	UTSW	16	33,875,261 (GRCm39)	missense	possibly damaging	0.61
R0614:Kalrn	UTSW	16	33,814,040 (GRCm39)	splice site	probably benign
R0656:Kalrn	UTSW	16	33,852,837 (GRCm39)	missense	probably damaging	1.00
R0671:Kalrn	UTSW	16	33,936,778 (GRCm39)	missense	probably benign	0.04
R0707:Kalrn	UTSW	16	33,830,951 (GRCm39)	missense	possibly damaging	0.88
R0709:Kalrn	UTSW	16	33,855,924 (GRCm39)	missense	probably damaging	1.00
R0834:Kalrn	UTSW	16	33,870,289 (GRCm39)	missense	possibly damaging	0.94
R0976:Kalrn	UTSW	16	34,205,760 (GRCm39)	missense	probably damaging	1.00
R1297:Kalrn	UTSW	16	33,836,868 (GRCm39)	missense	probably damaging	0.99
R1355:Kalrn	UTSW	16	33,795,954 (GRCm39)	missense	possibly damaging	0.74
R1370:Kalrn	UTSW	16	33,795,954 (GRCm39)	missense	possibly damaging	0.74
R1389:Kalrn	UTSW	16	33,809,173 (GRCm39)	missense	probably benign	0.01
R1398:Kalrn	UTSW	16	34,033,190 (GRCm39)	missense	probably damaging	1.00
R1427:Kalrn	UTSW	16	33,796,124 (GRCm39)	missense	probably damaging	1.00
R1458:Kalrn	UTSW	16	33,994,857 (GRCm39)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,007,841 (GRCm39)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,007,841 (GRCm39)	missense	probably damaging	1.00
R1557:Kalrn	UTSW	16	34,134,648 (GRCm39)	missense	possibly damaging	0.92
R1559:Kalrn	UTSW	16	33,830,918 (GRCm39)	missense	possibly damaging	0.92
R1654:Kalrn	UTSW	16	33,796,108 (GRCm39)	missense	probably damaging	1.00
R1703:Kalrn	UTSW	16	34,025,696 (GRCm39)	missense	probably damaging	1.00
R1759:Kalrn	UTSW	16	34,181,320 (GRCm39)	missense	probably damaging	0.97
R1764:Kalrn	UTSW	16	34,033,243 (GRCm39)	missense	probably damaging	1.00
R1824:Kalrn	UTSW	16	34,114,585 (GRCm39)	missense	probably damaging	1.00
R1845:Kalrn	UTSW	16	34,177,331 (GRCm39)	missense	probably damaging	0.99
R1850:Kalrn	UTSW	16	33,796,293 (GRCm39)	missense	probably damaging	0.98
R1921:Kalrn	UTSW	16	34,212,463 (GRCm39)	missense	probably benign	0.02
R1922:Kalrn	UTSW	16	34,212,463 (GRCm39)	missense	probably benign	0.02
R1970:Kalrn	UTSW	16	33,797,894 (GRCm39)	critical splice donor site	probably null
R1991:Kalrn	UTSW	16	33,796,108 (GRCm39)	missense	probably damaging	1.00
R1992:Kalrn	UTSW	16	33,796,108 (GRCm39)	missense	probably damaging	1.00
R2001:Kalrn	UTSW	16	33,848,415 (GRCm39)	missense	probably damaging	1.00
R2025:Kalrn	UTSW	16	34,010,106 (GRCm39)	missense	probably damaging	0.96
R2048:Kalrn	UTSW	16	34,072,680 (GRCm39)	missense	probably benign	0.18
R2076:Kalrn	UTSW	16	34,152,513 (GRCm39)	missense	probably benign	0.15
R2118:Kalrn	UTSW	16	34,152,600 (GRCm39)	missense	possibly damaging	0.84
R2136:Kalrn	UTSW	16	34,128,094 (GRCm39)	missense	possibly damaging	0.82
R2145:Kalrn	UTSW	16	33,829,632 (GRCm39)	unclassified	probably benign
R2193:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2195:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2234:Kalrn	UTSW	16	33,996,632 (GRCm39)	splice site	probably null
R2404:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2405:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2408:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2411:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2570:Kalrn	UTSW	16	34,130,865 (GRCm39)	missense	probably damaging	1.00
R2903:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2904:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2924:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R3411:Kalrn	UTSW	16	34,032,642 (GRCm39)	missense	probably benign	0.07
R3693:Kalrn	UTSW	16	34,177,685 (GRCm39)	missense	probably damaging	1.00
R3709:Kalrn	UTSW	16	34,212,400 (GRCm39)	splice site	probably null
R3788:Kalrn	UTSW	16	34,040,610 (GRCm39)	missense	probably damaging	1.00
R3833:Kalrn	UTSW	16	33,860,259 (GRCm39)	nonsense	probably null
R3871:Kalrn	UTSW	16	34,024,226 (GRCm39)	splice site	probably null
R3934:Kalrn	UTSW	16	34,130,901 (GRCm39)	missense	probably benign	0.34
R4033:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4056:Kalrn	UTSW	16	34,134,579 (GRCm39)	missense	probably damaging	0.99
R4057:Kalrn	UTSW	16	34,134,579 (GRCm39)	missense	probably damaging	0.99
R4303:Kalrn	UTSW	16	34,055,761 (GRCm39)	missense	probably damaging	1.00
R4402:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4444:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4482:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4487:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4558:Kalrn	UTSW	16	33,807,578 (GRCm39)	missense	possibly damaging	0.46
R4572:Kalrn	UTSW	16	34,212,412 (GRCm39)	missense	probably damaging	0.98
R4583:Kalrn	UTSW	16	34,055,637 (GRCm39)	missense	probably damaging	1.00
R4604:Kalrn	UTSW	16	34,334,296 (GRCm39)	missense	possibly damaging	0.46
R4620:Kalrn	UTSW	16	33,849,075 (GRCm39)	missense	probably damaging	0.99
R4651:Kalrn	UTSW	16	33,996,761 (GRCm39)	missense	probably damaging	1.00
R4703:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R4704:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R4705:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R4760:Kalrn	UTSW	16	34,018,857 (GRCm39)	missense	probably damaging	1.00
R4793:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4794:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4811:Kalrn	UTSW	16	34,177,339 (GRCm39)	missense	probably damaging	1.00
R4816:Kalrn	UTSW	16	34,334,389 (GRCm39)	unclassified	probably benign
R4888:Kalrn	UTSW	16	33,991,700 (GRCm39)	missense	probably damaging	1.00
R4952:Kalrn	UTSW	16	34,177,785 (GRCm39)	splice site	probably null
R5030:Kalrn	UTSW	16	33,796,112 (GRCm39)	missense	probably benign	0.00
R5045:Kalrn	UTSW	16	34,134,722 (GRCm39)	nonsense	probably null
R5117:Kalrn	UTSW	16	33,853,971 (GRCm39)	critical splice acceptor site	probably null
R5289:Kalrn	UTSW	16	34,072,711 (GRCm39)	missense	possibly damaging	0.95
R5426:Kalrn	UTSW	16	34,083,023 (GRCm39)	missense	probably damaging	1.00
R5432:Kalrn	UTSW	16	33,873,992 (GRCm39)	missense	probably damaging	1.00
R5611:Kalrn	UTSW	16	33,996,150 (GRCm39)	missense	probably damaging	1.00
R5629:Kalrn	UTSW	16	33,860,304 (GRCm39)	missense	possibly damaging	0.77
R5635:Kalrn	UTSW	16	33,834,454 (GRCm39)	missense	probably damaging	1.00
R5713:Kalrn	UTSW	16	33,836,949 (GRCm39)	missense	probably benign
R5716:Kalrn	UTSW	16	33,807,546 (GRCm39)	missense	probably benign	0.01
R5772:Kalrn	UTSW	16	33,796,190 (GRCm39)	missense	probably damaging	1.00
R5797:Kalrn	UTSW	16	34,032,619 (GRCm39)	missense	probably damaging	0.98
R5835:Kalrn	UTSW	16	33,807,461 (GRCm39)	missense	probably benign	0.28
R5895:Kalrn	UTSW	16	33,795,805 (GRCm39)	utr 3 prime	probably benign
R5924:Kalrn	UTSW	16	34,064,203 (GRCm39)	missense	probably damaging	1.00
R5999:Kalrn	UTSW	16	34,177,713 (GRCm39)	missense	probably damaging	1.00
R6010:Kalrn	UTSW	16	33,830,950 (GRCm39)	missense	probably benign	0.06
R6052:Kalrn	UTSW	16	34,181,255 (GRCm39)	missense	probably damaging	1.00
R6122:Kalrn	UTSW	16	33,805,561 (GRCm39)	missense	possibly damaging	0.82
R6128:Kalrn	UTSW	16	34,033,255 (GRCm39)	missense	probably damaging	0.99
R6136:Kalrn	UTSW	16	34,177,481 (GRCm39)	missense	probably damaging	1.00
R6178:Kalrn	UTSW	16	33,874,009 (GRCm39)	missense	possibly damaging	0.88
R6229:Kalrn	UTSW	16	33,875,441 (GRCm39)	missense	probably damaging	1.00
R6376:Kalrn	UTSW	16	33,796,361 (GRCm39)	missense	probably benign
R6397:Kalrn	UTSW	16	33,813,355 (GRCm39)	missense	probably damaging	1.00
R6429:Kalrn	UTSW	16	34,152,534 (GRCm39)	missense	possibly damaging	0.85
R6473:Kalrn	UTSW	16	34,025,672 (GRCm39)	missense	probably damaging	1.00
R6597:Kalrn	UTSW	16	34,003,117 (GRCm39)	missense	probably damaging	1.00
R6736:Kalrn	UTSW	16	34,038,293 (GRCm39)	missense	probably damaging	1.00
R6808:Kalrn	UTSW	16	33,848,346 (GRCm39)	missense	probably damaging	1.00
R6897:Kalrn	UTSW	16	33,796,073 (GRCm39)	missense	probably damaging	0.99
R6955:Kalrn	UTSW	16	34,040,506 (GRCm39)	missense	probably damaging	1.00
R7060:Kalrn	UTSW	16	34,177,418 (GRCm39)	missense	probably damaging	0.99
R7064:Kalrn	UTSW	16	34,038,261 (GRCm39)	missense	probably damaging	1.00
R7132:Kalrn	UTSW	16	34,076,597 (GRCm39)	missense	unknown
R7154:Kalrn	UTSW	16	34,032,527 (GRCm39)	critical splice donor site	probably null
R7181:Kalrn	UTSW	16	33,983,447 (GRCm39)	missense	probably benign	0.00
R7234:Kalrn	UTSW	16	33,996,792 (GRCm39)	missense	possibly damaging	0.63
R7235:Kalrn	UTSW	16	33,996,131 (GRCm39)	missense	probably benign	0.18
R7504:Kalrn	UTSW	16	34,076,603 (GRCm39)	missense	unknown
R7563:Kalrn	UTSW	16	34,212,464 (GRCm39)	missense	probably damaging	0.97
R7612:Kalrn	UTSW	16	34,134,582 (GRCm39)	missense	possibly damaging	0.68
R7772:Kalrn	UTSW	16	33,851,952 (GRCm39)	missense	probably benign	0.04
R7796:Kalrn	UTSW	16	34,007,854 (GRCm39)	nonsense	probably null
R7867:Kalrn	UTSW	16	33,810,161 (GRCm39)	missense	possibly damaging	0.94
R7869:Kalrn	UTSW	16	33,809,217 (GRCm39)	missense	probably damaging	0.98
R7914:Kalrn	UTSW	16	33,849,122 (GRCm39)	missense	probably benign
R8080:Kalrn	UTSW	16	33,796,038 (GRCm39)	missense	possibly damaging	0.83
R8147:Kalrn	UTSW	16	33,875,414 (GRCm39)	missense	probably benign
R8239:Kalrn	UTSW	16	33,870,153 (GRCm39)	missense	noncoding transcript
R8281:Kalrn	UTSW	16	33,855,431 (GRCm39)	nonsense	probably null
R8294:Kalrn	UTSW	16	33,853,954 (GRCm39)	missense	probably benign	0.12
R8301:Kalrn	UTSW	16	34,177,470 (GRCm39)	missense	probably benign	0.05
R8686:Kalrn	UTSW	16	34,181,305 (GRCm39)	missense	probably damaging	1.00
R8693:Kalrn	UTSW	16	33,854,884 (GRCm39)	missense	probably damaging	1.00
R8798:Kalrn	UTSW	16	33,803,225 (GRCm39)	missense	possibly damaging	0.65
R8878:Kalrn	UTSW	16	34,025,696 (GRCm39)	missense	probably damaging	1.00
R8878:Kalrn	UTSW	16	34,018,830 (GRCm39)	missense	probably benign	0.05
R8880:Kalrn	UTSW	16	34,038,305 (GRCm39)	missense	probably damaging	1.00
R8883:Kalrn	UTSW	16	33,814,025 (GRCm39)	missense	probably damaging	1.00
R8887:Kalrn	UTSW	16	34,047,496 (GRCm39)	missense	probably benign	0.22
R9048:Kalrn	UTSW	16	33,854,854 (GRCm39)	missense	possibly damaging	0.84
R9111:Kalrn	UTSW	16	34,181,371 (GRCm39)	missense	probably damaging	0.96
R9317:Kalrn	UTSW	16	33,834,045 (GRCm39)	missense
R9424:Kalrn	UTSW	16	33,809,188 (GRCm39)	missense	probably benign	0.06
R9442:Kalrn	UTSW	16	33,916,249 (GRCm39)	start codon destroyed	probably null	0.56
R9445:Kalrn	UTSW	16	33,805,600 (GRCm39)	missense	probably benign	0.13
R9515:Kalrn	UTSW	16	33,854,864 (GRCm39)	missense	probably damaging	1.00
R9516:Kalrn	UTSW	16	33,854,864 (GRCm39)	missense	probably damaging	1.00
R9625:Kalrn	UTSW	16	33,849,197 (GRCm39)	critical splice acceptor site	probably null
R9645:Kalrn	UTSW	16	34,032,583 (GRCm39)	missense	probably benign	0.01
RF014:Kalrn	UTSW	16	33,860,303 (GRCm39)	missense	probably benign	0.01
Z1177:Kalrn	UTSW	16	33,855,876 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGATTGCACAGAGGAGC -3'
(R):5'- GGCAGACCCTTTCAGTTGGTTAG -3'

Sequencing Primer
(F):5'- TGATTGCACAGAGGAGCAGGAAG -3'
(R):5'- GACCCTTTCAGTTGGTTAGAAAAATG -3'

Posted On

2018-05-21