Incidental Mutation 'R6482:Itgav'
ID517151
Institutional Source Beutler Lab
Gene Symbol Itgav
Ensembl Gene ENSMUSG00000027087
Gene Nameintegrin alpha V
Synonymsalphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6482 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location83724397-83806916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83794270 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 735 (S735P)
Ref Sequence ENSEMBL: ENSMUSP00000028499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]
Predicted Effect probably damaging
Transcript: ENSMUST00000028499
AA Change: S735P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: S735P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 248 298 4.9e-13 SMART
Int_alpha 302 363 4.55e-8 SMART
Int_alpha 366 422 2.2e-15 SMART
Int_alpha 430 484 1.62e-4 SMART
SCOP:d1m1xa2 629 767 3e-49 SMART
SCOP:d1m1xa3 768 982 1e-89 SMART
low complexity region 995 1008 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111740
AA Change: S699P

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: S699P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 212 262 4.9e-13 SMART
Int_alpha 266 327 4.55e-8 SMART
Int_alpha 330 386 2.2e-15 SMART
Int_alpha 394 448 1.62e-4 SMART
SCOP:d1m1xa2 593 731 5e-49 SMART
SCOP:d1m1xa3 732 946 2e-89 SMART
low complexity region 959 972 N/A INTRINSIC
Pfam:Integrin_alpha 977 991 1.3e-7 PFAM
Meta Mutation Damage Score 0.0356 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl T C 11: 70,011,562 I415V probably benign Het
Akap8l A G 17: 32,345,396 F6L possibly damaging Het
Ano3 T A 2: 110,697,055 N603Y probably damaging Het
Casp8ap2 T C 4: 32,634,813 S116P probably damaging Het
Ccdc110 A T 8: 45,942,788 Q572L probably benign Het
Chit1 T C 1: 134,143,242 S20P probably damaging Het
Col22a1 G A 15: 71,890,489 P107L possibly damaging Het
Dpys T C 15: 39,841,973 H248R probably damaging Het
Dsg2 A T 18: 20,601,314 K783I possibly damaging Het
Efnb2 A T 8: 8,620,637 V321E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Gm21936 A G 12: 87,795,795 Y95C probably damaging Het
Gm35315 A T 5: 110,078,089 C495S possibly damaging Het
Hrh1 A G 6: 114,480,763 Q335R possibly damaging Het
Il12rb2 A G 6: 67,356,686 L203P probably damaging Het
Klrg1 G T 6: 122,271,453 C162* probably null Het
Mcc T C 18: 44,445,864 S651G possibly damaging Het
Nkx2-2 T A 2: 147,185,976 I15F probably damaging Het
Nppa G A 4: 148,000,871 V13I probably benign Het
Olfr1104 G C 2: 87,022,525 F6L probably benign Het
Pde2a A G 7: 101,501,037 N228D probably benign Het
Pgpep1l C T 7: 68,239,067 probably null Het
Plekhg3 A G 12: 76,576,004 N673D probably benign Het
Plxna4 A G 6: 32,516,737 S315P probably benign Het
Psg21 A T 7: 18,654,739 probably null Het
Rnf111 T C 9: 70,429,607 T925A probably damaging Het
Rnf219 A T 14: 104,479,817 C373* probably null Het
Spag9 T C 11: 94,093,502 F734L possibly damaging Het
Tarbp1 A G 8: 126,450,695 V746A probably benign Het
Tmtc1 A G 6: 148,412,745 F119L probably benign Het
Ttc21b A G 2: 66,226,900 M576T probably benign Het
Usp48 T A 4: 137,634,921 V765E probably damaging Het
Vmn1r20 A G 6: 57,432,108 S140G probably benign Het
Vwde A G 6: 13,205,844 S235P probably damaging Het
Wapl A G 14: 34,692,692 S504G probably benign Het
Wnt5b A T 6: 119,433,612 L289Q possibly damaging Het
Zfp142 G A 1: 74,570,217 probably null Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zfp948 A G 17: 21,587,551 H335R probably benign Het
Other mutations in Itgav
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Itgav APN 2 83802995 missense probably damaging 1.00
IGL01969:Itgav APN 2 83803283 missense probably damaging 1.00
IGL02371:Itgav APN 2 83770053 missense probably damaging 1.00
IGL02563:Itgav APN 2 83771236 missense probably benign
IGL02640:Itgav APN 2 83791939 missense probably benign 0.33
IGL02641:Itgav APN 2 83768345 splice site probably benign
IGL02927:Itgav APN 2 83795540 missense probably damaging 1.00
IGL03172:Itgav APN 2 83765846 missense possibly damaging 0.51
R0158:Itgav UTSW 2 83792037 missense probably benign 0.33
R0346:Itgav UTSW 2 83792609 missense probably damaging 1.00
R0508:Itgav UTSW 2 83792658 splice site probably benign
R0546:Itgav UTSW 2 83803242 missense probably benign 0.04
R0554:Itgav UTSW 2 83794270 missense possibly damaging 0.95
R1122:Itgav UTSW 2 83791939 missense probably benign 0.33
R1468:Itgav UTSW 2 83765901 splice site probably benign
R1566:Itgav UTSW 2 83736630 missense probably damaging 1.00
R1657:Itgav UTSW 2 83801779 missense probably benign 0.21
R1892:Itgav UTSW 2 83771336 missense probably damaging 1.00
R1912:Itgav UTSW 2 83795486 missense possibly damaging 0.85
R2176:Itgav UTSW 2 83803255 missense probably damaging 1.00
R2438:Itgav UTSW 2 83776542 missense probably damaging 1.00
R2449:Itgav UTSW 2 83768750 critical splice donor site probably null
R3110:Itgav UTSW 2 83792571 nonsense probably null
R3112:Itgav UTSW 2 83792571 nonsense probably null
R3176:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3177:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3276:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3277:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3766:Itgav UTSW 2 83801885 critical splice donor site probably null
R3774:Itgav UTSW 2 83791964 missense probably damaging 1.00
R3880:Itgav UTSW 2 83768301 missense probably damaging 1.00
R4196:Itgav UTSW 2 83768327 missense probably benign 0.24
R4287:Itgav UTSW 2 83724840 nonsense probably null
R4620:Itgav UTSW 2 83755902 missense probably benign 0.07
R4790:Itgav UTSW 2 83755810 missense probably damaging 1.00
R4946:Itgav UTSW 2 83788983 missense probably benign 0.16
R6150:Itgav UTSW 2 83776436 missense probably benign
R6345:Itgav UTSW 2 83802036 missense probably damaging 1.00
R6900:Itgav UTSW 2 83803247 missense probably damaging 1.00
R7247:Itgav UTSW 2 83724835 missense probably damaging 0.98
R7317:Itgav UTSW 2 83794983 missense probably benign 0.12
R7429:Itgav UTSW 2 83794258 missense probably damaging 1.00
R7430:Itgav UTSW 2 83794258 missense probably damaging 1.00
R7522:Itgav UTSW 2 83802029 missense probably benign 0.10
R7546:Itgav UTSW 2 83776550 nonsense probably null
V1662:Itgav UTSW 2 83783854 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGACTTCAGTGGAAAATCAGTTG -3'
(R):5'- AAAGATGGAGAAAAGCTGTATTTCC -3'

Sequencing Primer
(F):5'- CATGAGAGTGTATTTTAGAACCC -3'
(R):5'- CACATGGCATTTACACGTGG -3'
Posted On2018-05-21