Incidental Mutation 'R6484:Hip1'
ID517252
Institutional Source Beutler Lab
Gene Symbol Hip1
Ensembl Gene ENSMUSG00000039959
Gene Namehuntingtin interacting protein 1
SynonymsHIP-1, 2610109B09Rik, A930014B11Rik, E130315I21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R6484 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location135406531-135545120 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135440129 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 280 (S280P)
Ref Sequence ENSEMBL: ENSMUSP00000148842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060311] [ENSMUST00000202643] [ENSMUST00000212301]
Predicted Effect probably damaging
Transcript: ENSMUST00000060311
AA Change: S305P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059033
Gene: ENSMUSG00000039959
AA Change: S305P

DomainStartEndE-ValueType
ENTH 38 160 9.98e-41 SMART
PDB:3I00|B 361 480 9e-57 PDB
Pfam:HIP1_clath_bdg 482 572 2.1e-27 PFAM
low complexity region 649 658 N/A INTRINSIC
low complexity region 780 796 N/A INTRINSIC
ILWEQ 806 1004 9.05e-120 SMART
Predicted Effect unknown
Transcript: ENSMUST00000200808
AA Change: S37P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202236
Predicted Effect probably benign
Transcript: ENSMUST00000202643
SMART Domains Protein: ENSMUSP00000144086
Gene: ENSMUSG00000039959

DomainStartEndE-ValueType
PDB:2QA7|D 1 70 9e-34 PDB
Pfam:HIP1_clath_bdg 71 161 4.4e-24 PFAM
low complexity region 238 247 N/A INTRINSIC
low complexity region 369 385 N/A INTRINSIC
ILWEQ 395 593 5.7e-122 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212301
AA Change: S280P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that functions in clathrin-mediated endocytosis and protein trafficking within the cell. The encoded protein binds to the huntingtin protein in the brain; this interaction is lost in Huntington's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutants may exhibit axial skeleton defects, hematopotietic abnormalities, and testicular degeneration with increased apoptosis of postmeiotic spermatids. One line showed microphthalmia and cataracts, whereas others did not. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,279,095 V1548A probably damaging Het
3110062M04Rik G A 6: 34,874,616 S101L probably damaging Het
Abce1 A T 8: 79,690,323 M353K probably damaging Het
Adgre4 G A 17: 55,802,036 V348M possibly damaging Het
Alg8 T C 7: 97,382,928 V228A probably benign Het
Btbd8 T C 5: 107,503,585 S115P probably benign Het
Car8 A G 4: 8,189,362 F151L probably benign Het
CN725425 A G 15: 91,260,572 Q546R probably benign Het
Col17a1 C T 19: 47,670,429 V414M possibly damaging Het
Col6a3 C A 1: 90,791,923 probably null Het
Cyp51 G A 5: 4,086,627 T389M probably benign Het
Dazap1 A G 10: 80,277,647 T126A probably benign Het
Dscc1 T A 15: 55,080,290 K395* probably null Het
Dthd1 A G 5: 62,814,332 N166S probably benign Het
Eefsec C G 6: 88,297,788 W398S probably damaging Het
Enpep T A 3: 129,321,481 H214L probably damaging Het
Esf1 T C 2: 140,158,538 I443V probably benign Het
Espl1 T C 15: 102,323,500 V1984A possibly damaging Het
Il12rb1 C T 8: 70,809,704 probably null Het
Itgax T A 7: 128,133,718 C255S probably benign Het
Kifc5b T C 17: 26,924,772 V506A probably damaging Het
Klf3 A G 5: 64,823,029 E54G probably damaging Het
Lrig3 A G 10: 125,996,609 probably null Het
Mctp1 A G 13: 76,688,625 I104V probably benign Het
Mdga2 T C 12: 66,630,069 E552G possibly damaging Het
Mpc1 A G 17: 8,296,956 E160G possibly damaging Het
Myh10 T A 11: 68,699,467 I76N probably damaging Het
Myh7b A T 2: 155,628,643 I1032F probably benign Het
Olfml2a G A 2: 38,959,768 V499I probably damaging Het
Olfr1311 A T 2: 112,021,419 L145* probably null Het
Olfr1458 A G 19: 13,103,067 V79A probably benign Het
Olfr91 T A 17: 37,093,266 I203F probably benign Het
P2ry12 A G 3: 59,217,333 L307P probably damaging Het
Pappa C A 4: 65,314,659 A1345D probably damaging Het
Phox2b A G 5: 67,097,701 I135T possibly damaging Het
Poln C T 5: 34,129,513 A104T probably benign Het
Prkce A G 17: 86,490,809 D342G probably benign Het
Ptchd3 T A 11: 121,842,938 F885I possibly damaging Het
Rcbtb2 A T 14: 73,177,050 S434C probably damaging Het
Rfc1 A G 5: 65,293,677 V356A probably benign Het
Rln1 A G 19: 29,334,502 F32S probably benign Het
Ryr2 A G 13: 11,662,383 L3194P possibly damaging Het
Sat2 T C 11: 69,622,527 V34A probably damaging Het
Scgb3a2 T C 18: 43,766,719 I24T possibly damaging Het
Slc35e2 T G 4: 155,612,647 V206G probably damaging Het
Slit3 A T 11: 35,661,298 M890L probably benign Het
Sorl1 A G 9: 41,976,407 L2042P probably damaging Het
Ssbp1 T A 6: 40,474,666 V9E probably damaging Het
Tbc1d23 C T 16: 57,178,016 V520M probably damaging Het
Thumpd2 T C 17: 81,054,188 E203G probably benign Het
Tlr11 A G 14: 50,362,678 D707G probably damaging Het
Tlr12 T A 4: 128,616,054 D801V probably damaging Het
Tnrc6b T G 15: 80,879,324 N342K possibly damaging Het
Vmn1r191 A C 13: 22,178,748 F279V probably benign Het
Vmn2r13 A T 5: 109,156,674 C630* probably null Het
Zbtb1 C T 12: 76,385,891 T217I probably damaging Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zzef1 C T 11: 72,895,271 P2090S probably damaging Het
Other mutations in Hip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Hip1 APN 5 135449822 missense probably damaging 1.00
IGL00418:Hip1 APN 5 135426346 missense probably damaging 1.00
IGL01744:Hip1 APN 5 135545063 utr 5 prime probably benign
IGL02494:Hip1 APN 5 135444791 nonsense probably null
IGL02749:Hip1 APN 5 135444751 missense probably benign 0.00
IGL03219:Hip1 APN 5 135457050 missense probably benign 0.16
IGL03328:Hip1 APN 5 135424874 missense probably damaging 1.00
R0100:Hip1 UTSW 5 135436453 missense probably benign
R0100:Hip1 UTSW 5 135436453 missense probably benign
R0336:Hip1 UTSW 5 135428613 missense probably benign 0.39
R0410:Hip1 UTSW 5 135458155 missense probably damaging 1.00
R1454:Hip1 UTSW 5 135438632 missense probably benign
R1530:Hip1 UTSW 5 135444780 missense probably damaging 1.00
R1848:Hip1 UTSW 5 135435141 unclassified probably null
R2201:Hip1 UTSW 5 135431730 missense probably benign
R2246:Hip1 UTSW 5 135452844 missense probably damaging 1.00
R2276:Hip1 UTSW 5 135457046 missense probably damaging 1.00
R2353:Hip1 UTSW 5 135412712 missense probably damaging 1.00
R3013:Hip1 UTSW 5 135435039 missense possibly damaging 0.91
R3413:Hip1 UTSW 5 135422172 missense probably damaging 1.00
R3939:Hip1 UTSW 5 135428764 missense probably benign 0.14
R4153:Hip1 UTSW 5 135412706 missense probably damaging 1.00
R4839:Hip1 UTSW 5 135426318 splice site probably null
R5059:Hip1 UTSW 5 135449821 missense probably damaging 1.00
R5171:Hip1 UTSW 5 135440302 missense probably damaging 1.00
R5189:Hip1 UTSW 5 135434293 missense probably damaging 1.00
R5358:Hip1 UTSW 5 135436398 missense probably benign 0.22
R5642:Hip1 UTSW 5 135433085 nonsense probably null
R5646:Hip1 UTSW 5 135428741 missense probably damaging 0.98
R5831:Hip1 UTSW 5 135411263 missense probably benign 0.00
R5908:Hip1 UTSW 5 135424863 critical splice donor site probably null
R6535:Hip1 UTSW 5 135428497 splice site probably null
R6557:Hip1 UTSW 5 135428719 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CGAGCAGACCTAATCTAAGCAG -3'
(R):5'- TGAAAGATCTGTTTCAGCGCTCC -3'

Sequencing Primer
(F):5'- ATCTAAGCAGATAGACCTAAGCTAG -3'
(R):5'- GTTTCAGCGCTCCAGCAAC -3'
Posted On2018-05-21