Incidental Mutation 'R6484:Tlr11'
ID517272
Institutional Source Beutler Lab
Gene Symbol Tlr11
Ensembl Gene ENSMUSG00000051969
Gene Nametoll-like receptor 11
SynonymsLOC239081
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6484 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50357914-50363663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50362678 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 707 (D707G)
Ref Sequence ENSEMBL: ENSMUSP00000138814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063570] [ENSMUST00000185091]
Predicted Effect probably damaging
Transcript: ENSMUST00000063570
AA Change: D702G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068906
Gene: ENSMUSG00000051969
AA Change: D702G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 105 122 N/A INTRINSIC
low complexity region 153 161 N/A INTRINSIC
LRR 311 333 3.36e1 SMART
LRR 335 361 4.44e0 SMART
LRR 362 383 2.03e1 SMART
LRR_TYP 384 407 2.57e-3 SMART
LRR_TYP 408 431 2.75e-3 SMART
low complexity region 544 556 N/A INTRINSIC
LRR 605 628 6.06e1 SMART
transmembrane domain 719 741 N/A INTRINSIC
Pfam:TIR 773 922 2.1e-9 PFAM
Pfam:TIR_2 776 894 6.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185091
AA Change: D707G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138814
Gene: ENSMUSG00000051969
AA Change: D707G

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
low complexity region 110 127 N/A INTRINSIC
low complexity region 158 166 N/A INTRINSIC
Pfam:LRR_6 221 244 5.3e-2 PFAM
LRR 316 338 3.36e1 SMART
LRR 340 366 4.44e0 SMART
LRR 367 388 2.03e1 SMART
LRR_TYP 389 412 2.57e-3 SMART
LRR_TYP 413 436 2.75e-3 SMART
low complexity region 549 561 N/A INTRINSIC
LRR 610 633 6.06e1 SMART
transmembrane domain 724 746 N/A INTRINSIC
Pfam:TIR_2 781 898 1e-12 PFAM
Pfam:TIR 781 922 1.8e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.7%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,279,095 V1548A probably damaging Het
3110062M04Rik G A 6: 34,874,616 S101L probably damaging Het
Abce1 A T 8: 79,690,323 M353K probably damaging Het
Adgre4 G A 17: 55,802,036 V348M possibly damaging Het
Alg8 T C 7: 97,382,928 V228A probably benign Het
Btbd8 T C 5: 107,503,585 S115P probably benign Het
Car8 A G 4: 8,189,362 F151L probably benign Het
CN725425 A G 15: 91,260,572 Q546R probably benign Het
Col17a1 C T 19: 47,670,429 V414M possibly damaging Het
Col6a3 C A 1: 90,791,923 probably null Het
Cyp51 G A 5: 4,086,627 T389M probably benign Het
Dazap1 A G 10: 80,277,647 T126A probably benign Het
Dscc1 T A 15: 55,080,290 K395* probably null Het
Dthd1 A G 5: 62,814,332 N166S probably benign Het
Eefsec C G 6: 88,297,788 W398S probably damaging Het
Enpep T A 3: 129,321,481 H214L probably damaging Het
Esf1 T C 2: 140,158,538 I443V probably benign Het
Espl1 T C 15: 102,323,500 V1984A possibly damaging Het
Hip1 A G 5: 135,440,129 S280P probably damaging Het
Il12rb1 C T 8: 70,809,704 probably null Het
Itgax T A 7: 128,133,718 C255S probably benign Het
Kifc5b T C 17: 26,924,772 V506A probably damaging Het
Klf3 A G 5: 64,823,029 E54G probably damaging Het
Lrig3 A G 10: 125,996,609 probably null Het
Mctp1 A G 13: 76,688,625 I104V probably benign Het
Mdga2 T C 12: 66,630,069 E552G possibly damaging Het
Mpc1 A G 17: 8,296,956 E160G possibly damaging Het
Myh10 T A 11: 68,699,467 I76N probably damaging Het
Myh7b A T 2: 155,628,643 I1032F probably benign Het
Olfml2a G A 2: 38,959,768 V499I probably damaging Het
Olfr1311 A T 2: 112,021,419 L145* probably null Het
Olfr1458 A G 19: 13,103,067 V79A probably benign Het
Olfr91 T A 17: 37,093,266 I203F probably benign Het
P2ry12 A G 3: 59,217,333 L307P probably damaging Het
Pappa C A 4: 65,314,659 A1345D probably damaging Het
Phox2b A G 5: 67,097,701 I135T possibly damaging Het
Poln C T 5: 34,129,513 A104T probably benign Het
Prkce A G 17: 86,490,809 D342G probably benign Het
Ptchd3 T A 11: 121,842,938 F885I possibly damaging Het
Rcbtb2 A T 14: 73,177,050 S434C probably damaging Het
Rfc1 A G 5: 65,293,677 V356A probably benign Het
Rln1 A G 19: 29,334,502 F32S probably benign Het
Ryr2 A G 13: 11,662,383 L3194P possibly damaging Het
Sat2 T C 11: 69,622,527 V34A probably damaging Het
Scgb3a2 T C 18: 43,766,719 I24T possibly damaging Het
Slc35e2 T G 4: 155,612,647 V206G probably damaging Het
Slit3 A T 11: 35,661,298 M890L probably benign Het
Sorl1 A G 9: 41,976,407 L2042P probably damaging Het
Ssbp1 T A 6: 40,474,666 V9E probably damaging Het
Tbc1d23 C T 16: 57,178,016 V520M probably damaging Het
Thumpd2 T C 17: 81,054,188 E203G probably benign Het
Tlr12 T A 4: 128,616,054 D801V probably damaging Het
Tnrc6b T G 15: 80,879,324 N342K possibly damaging Het
Vmn1r191 A C 13: 22,178,748 F279V probably benign Het
Vmn2r13 A T 5: 109,156,674 C630* probably null Het
Zbtb1 C T 12: 76,385,891 T217I probably damaging Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zzef1 C T 11: 72,895,271 P2090S probably damaging Het
Other mutations in Tlr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Tlr11 APN 14 50360916 missense probably benign
IGL02090:Tlr11 APN 14 50363032 missense probably damaging 0.99
IGL02286:Tlr11 APN 14 50360871 missense possibly damaging 0.91
IGL02671:Tlr11 APN 14 50360692 missense probably damaging 1.00
IGL03064:Tlr11 APN 14 50361100 missense probably damaging 1.00
IGL03068:Tlr11 APN 14 50361484 missense probably benign
R0099:Tlr11 UTSW 14 50360818 missense probably benign 0.14
R0727:Tlr11 UTSW 14 50361469 missense possibly damaging 0.67
R0944:Tlr11 UTSW 14 50362336 missense probably benign 0.12
R1490:Tlr11 UTSW 14 50363176 missense probably benign 0.00
R1726:Tlr11 UTSW 14 50361541 missense probably benign 0.00
R1803:Tlr11 UTSW 14 50360647 missense probably benign 0.00
R1908:Tlr11 UTSW 14 50361207 missense probably benign 0.00
R1971:Tlr11 UTSW 14 50361234 missense probably benign
R1981:Tlr11 UTSW 14 50361988 missense possibly damaging 0.95
R2023:Tlr11 UTSW 14 50362569 missense probably damaging 0.96
R2079:Tlr11 UTSW 14 50360980 missense probably damaging 0.99
R2155:Tlr11 UTSW 14 50360682 missense probably benign 0.01
R2251:Tlr11 UTSW 14 50360792 missense probably benign 0.02
R3017:Tlr11 UTSW 14 50362721 nonsense probably null
R3760:Tlr11 UTSW 14 50362243 missense probably damaging 1.00
R3876:Tlr11 UTSW 14 50363154 missense probably benign
R3936:Tlr11 UTSW 14 50362735 missense possibly damaging 0.78
R4002:Tlr11 UTSW 14 50362527 missense probably benign
R4024:Tlr11 UTSW 14 50362846 missense probably benign 0.02
R4118:Tlr11 UTSW 14 50363227 missense probably damaging 1.00
R4222:Tlr11 UTSW 14 50361849 missense probably damaging 0.99
R4365:Tlr11 UTSW 14 50361469 missense probably damaging 0.98
R4678:Tlr11 UTSW 14 50360982 missense possibly damaging 0.85
R4779:Tlr11 UTSW 14 50361250 missense possibly damaging 0.76
R4910:Tlr11 UTSW 14 50362889 missense probably benign 0.45
R4921:Tlr11 UTSW 14 50362885 missense possibly damaging 0.48
R5114:Tlr11 UTSW 14 50363121 missense possibly damaging 0.81
R5126:Tlr11 UTSW 14 50360830 missense probably damaging 1.00
R5349:Tlr11 UTSW 14 50360880 missense probably benign 0.45
R5606:Tlr11 UTSW 14 50362260 missense probably benign 0.08
R5650:Tlr11 UTSW 14 50361201 missense probably benign 0.03
R5958:Tlr11 UTSW 14 50360777 missense probably damaging 0.99
R5966:Tlr11 UTSW 14 50362255 missense probably benign 0.02
R6480:Tlr11 UTSW 14 50363055 missense possibly damaging 0.62
R6679:Tlr11 UTSW 14 50362854 missense probably benign 0.00
R6717:Tlr11 UTSW 14 50362104 missense probably benign
R7085:Tlr11 UTSW 14 50362656 missense probably damaging 0.99
Z1088:Tlr11 UTSW 14 50362338 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCAACTCTGAAAGGGCGCTG -3'
(R):5'- TGGCCTCTGAGTCTATGTCCAC -3'

Sequencing Primer
(F):5'- TGGAGATGAACAGCAACCTC -3'
(R):5'- GAGTCTATGTCCACATAATTTCCAC -3'
Posted On2018-05-21