Incidental Mutation 'R6484:Scgb3a2'
ID517284
Institutional Source Beutler Lab
Gene Symbol Scgb3a2
Ensembl Gene ENSMUSG00000038791
Gene Namesecretoglobin, family 3A, member 2
SynonymsLuLeu1, UGRP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6484 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location43764289-43767399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43766719 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 24 (I24T)
Ref Sequence ENSEMBL: ENSMUSP00000038872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043803] [ENSMUST00000187157] [ENSMUST00000189750]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043803
AA Change: I24T

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038872
Gene: ENSMUSG00000038791
AA Change: I24T

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:Uteroglobin 30 98 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187157
AA Change: I24T

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140476
Gene: ENSMUSG00000038791
AA Change: I24T

DomainStartEndE-ValueType
Pfam:Uteroglobin 27 88 8.9e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000189750
AA Change: I24T

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140375
Gene: ENSMUSG00000038791
AA Change: I24T

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:Uteroglobin 27 98 3.2e-20 PFAM
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted lung surfactant protein and a downstream target of thyroid transcription factor. A single nucleotide polymorphism in the promoter of this gene results in susceptibility to asthma.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,279,095 V1548A probably damaging Het
3110062M04Rik G A 6: 34,874,616 S101L probably damaging Het
Abce1 A T 8: 79,690,323 M353K probably damaging Het
Adgre4 G A 17: 55,802,036 V348M possibly damaging Het
Alg8 T C 7: 97,382,928 V228A probably benign Het
Btbd8 T C 5: 107,503,585 S115P probably benign Het
Car8 A G 4: 8,189,362 F151L probably benign Het
CN725425 A G 15: 91,260,572 Q546R probably benign Het
Col17a1 C T 19: 47,670,429 V414M possibly damaging Het
Col6a3 C A 1: 90,791,923 probably null Het
Cyp51 G A 5: 4,086,627 T389M probably benign Het
Dazap1 A G 10: 80,277,647 T126A probably benign Het
Dscc1 T A 15: 55,080,290 K395* probably null Het
Dthd1 A G 5: 62,814,332 N166S probably benign Het
Eefsec C G 6: 88,297,788 W398S probably damaging Het
Enpep T A 3: 129,321,481 H214L probably damaging Het
Esf1 T C 2: 140,158,538 I443V probably benign Het
Espl1 T C 15: 102,323,500 V1984A possibly damaging Het
Hip1 A G 5: 135,440,129 S280P probably damaging Het
Il12rb1 C T 8: 70,809,704 probably null Het
Itgax T A 7: 128,133,718 C255S probably benign Het
Kifc5b T C 17: 26,924,772 V506A probably damaging Het
Klf3 A G 5: 64,823,029 E54G probably damaging Het
Lrig3 A G 10: 125,996,609 probably null Het
Mctp1 A G 13: 76,688,625 I104V probably benign Het
Mdga2 T C 12: 66,630,069 E552G possibly damaging Het
Mpc1 A G 17: 8,296,956 E160G possibly damaging Het
Myh10 T A 11: 68,699,467 I76N probably damaging Het
Myh7b A T 2: 155,628,643 I1032F probably benign Het
Olfml2a G A 2: 38,959,768 V499I probably damaging Het
Olfr1311 A T 2: 112,021,419 L145* probably null Het
Olfr1458 A G 19: 13,103,067 V79A probably benign Het
Olfr91 T A 17: 37,093,266 I203F probably benign Het
P2ry12 A G 3: 59,217,333 L307P probably damaging Het
Pappa C A 4: 65,314,659 A1345D probably damaging Het
Phox2b A G 5: 67,097,701 I135T possibly damaging Het
Poln C T 5: 34,129,513 A104T probably benign Het
Prkce A G 17: 86,490,809 D342G probably benign Het
Ptchd3 T A 11: 121,842,938 F885I possibly damaging Het
Rcbtb2 A T 14: 73,177,050 S434C probably damaging Het
Rfc1 A G 5: 65,293,677 V356A probably benign Het
Rln1 A G 19: 29,334,502 F32S probably benign Het
Ryr2 A G 13: 11,662,383 L3194P possibly damaging Het
Sat2 T C 11: 69,622,527 V34A probably damaging Het
Slc35e2 T G 4: 155,612,647 V206G probably damaging Het
Slit3 A T 11: 35,661,298 M890L probably benign Het
Sorl1 A G 9: 41,976,407 L2042P probably damaging Het
Ssbp1 T A 6: 40,474,666 V9E probably damaging Het
Tbc1d23 C T 16: 57,178,016 V520M probably damaging Het
Thumpd2 T C 17: 81,054,188 E203G probably benign Het
Tlr11 A G 14: 50,362,678 D707G probably damaging Het
Tlr12 T A 4: 128,616,054 D801V probably damaging Het
Tnrc6b T G 15: 80,879,324 N342K possibly damaging Het
Vmn1r191 A C 13: 22,178,748 F279V probably benign Het
Vmn2r13 A T 5: 109,156,674 C630* probably null Het
Zbtb1 C T 12: 76,385,891 T217I probably damaging Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zzef1 C T 11: 72,895,271 P2090S probably damaging Het
Other mutations in Scgb3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Scgb3a2 APN 18 43767029 intron probably benign
IGL01112:Scgb3a2 APN 18 43766994 intron probably benign
R0881:Scgb3a2 UTSW 18 43764484 splice site probably benign
R1781:Scgb3a2 UTSW 18 43766968 critical splice donor site probably benign
R1857:Scgb3a2 UTSW 18 43766835 missense probably benign 0.03
R4856:Scgb3a2 UTSW 18 43766754 missense probably damaging 1.00
R4886:Scgb3a2 UTSW 18 43766754 missense probably damaging 1.00
R6980:Scgb3a2 UTSW 18 43764434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTCTAGGGAGATGGACTGC -3'
(R):5'- GCTTCTCCCAGGGAAATAAGAAC -3'

Sequencing Primer
(F):5'- TGGACTGCCATATGCCATG -3'
(R):5'- ATTACCAGAAGCTTCTTCACGG -3'
Posted On2018-05-21