Incidental Mutation 'R6485:Col6a4'
ID517305
Institutional Source Beutler Lab
Gene Symbol Col6a4
Ensembl Gene ENSMUSG00000032572
Gene Namecollagen, type VI, alpha 4
SynonymsVwa6, 1110001D15Rik, EG235580, Dvwa
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6485 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location105989454-106096783 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 106076870 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121963]
Predicted Effect probably null
Transcript: ENSMUST00000121963
SMART Domains Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWA 32 211 2.44e-35 SMART
VWA 233 410 8.67e-50 SMART
VWA 428 604 2.74e-29 SMART
VWA 632 816 4.78e-20 SMART
VWA 847 1019 3.02e-40 SMART
VWA 1028 1204 3.17e-43 SMART
VWA 1210 1391 4.73e-1 SMART
low complexity region 1444 1462 N/A INTRINSIC
PDB:3HR2|B 1469 1593 3e-7 PDB
low complexity region 1594 1622 N/A INTRINSIC
low complexity region 1625 1643 N/A INTRINSIC
low complexity region 1649 1671 N/A INTRINSIC
Pfam:Collagen 1684 1748 1.4e-9 PFAM
VWA 1774 1953 2.18e-14 SMART
VWA 1980 2174 1.89e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137847
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C A 7: 120,427,167 Y117* probably null Het
Acot5 A T 12: 84,075,484 R281W probably damaging Het
Adamts20 T C 15: 94,343,971 T719A probably benign Het
Arhgap33 T C 7: 30,524,004 T867A probably benign Het
Bcl2a1c T C 9: 114,330,210 Y19H probably benign Het
Bod1l A G 5: 41,817,116 I2285T possibly damaging Het
Cacna2d1 A G 5: 16,354,657 Y755C probably damaging Het
Cdc27 T C 11: 104,505,648 T816A probably benign Het
Clasrp C A 7: 19,586,369 probably benign Het
Cpd T C 11: 76,808,707 probably null Het
Crispld2 A G 8: 120,029,309 D339G probably damaging Het
Dst A G 1: 34,294,529 D7046G probably damaging Het
Erbin G T 13: 103,868,113 Q136K probably damaging Het
Exph5 G A 9: 53,376,691 E1691K possibly damaging Het
Fads6 A G 11: 115,285,438 F187S probably benign Het
Foxg1 A T 12: 49,385,080 I199F probably damaging Het
Garem1 T C 18: 21,129,837 D640G probably benign Het
Gba2 A C 4: 43,574,118 Y112D probably damaging Het
Gcfc2 T C 6: 81,939,547 I323T probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria4 T A 9: 4,464,249 Y571F probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lonrf1 A G 8: 36,229,134 probably null Het
Mrgprb5 T C 7: 48,168,777 N70S probably damaging Het
Muc2 T A 7: 141,746,736 probably benign Het
Nol4 T C 18: 22,770,793 D375G probably damaging Het
Olfr1359 A G 13: 21,703,430 Q143R probably benign Het
Pcnt G T 10: 76,389,330 S1780* probably null Het
Pdgfra A T 5: 75,175,074 probably null Het
Pgd A T 4: 149,156,419 probably null Het
Pla2g6 T C 15: 79,307,372 I279V probably benign Het
Ptpn21 A T 12: 98,698,872 C297* probably null Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rtcb T C 10: 85,957,644 I22V probably benign Het
Slc25a30 G T 14: 75,775,007 A67E probably damaging Het
Stk11ip T C 1: 75,529,968 V605A possibly damaging Het
Ush1c A T 7: 46,209,110 S585T probably benign Het
Vps13a T C 19: 16,680,050 D1785G probably damaging Het
Zic5 T A 14: 122,459,640 Y521F unknown Het
Other mutations in Col6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Col6a4 APN 9 106022896 missense probably benign 0.00
IGL00691:Col6a4 APN 9 106057407 missense probably damaging 1.00
IGL01508:Col6a4 APN 9 106013605 missense possibly damaging 0.95
IGL01580:Col6a4 APN 9 106068198 missense probably damaging 1.00
IGL01610:Col6a4 APN 9 106047707 splice site probably benign
IGL01813:Col6a4 APN 9 106077253 missense probably damaging 1.00
IGL01933:Col6a4 APN 9 106060114 missense probably benign 0.04
IGL01973:Col6a4 APN 9 106062894 missense probably damaging 1.00
IGL02053:Col6a4 APN 9 106063095 missense possibly damaging 0.92
IGL02063:Col6a4 APN 9 106057418 missense probably benign 0.01
IGL02065:Col6a4 APN 9 106077103 missense probably damaging 0.99
IGL02106:Col6a4 APN 9 106063105 missense possibly damaging 0.95
IGL02220:Col6a4 APN 9 106062942 missense possibly damaging 0.91
IGL02228:Col6a4 APN 9 106068078 missense probably benign
IGL02234:Col6a4 APN 9 106013432 missense possibly damaging 0.92
IGL02294:Col6a4 APN 9 106066732 missense probably benign 0.04
IGL02314:Col6a4 APN 9 105997156 missense probably damaging 0.99
IGL03065:Col6a4 APN 9 106041164 splice site probably benign
IGL03086:Col6a4 APN 9 106082862 splice site probably benign
IGL03185:Col6a4 APN 9 106019454 missense probably damaging 0.97
R0092:Col6a4 UTSW 9 106013314 missense probably benign 0.04
R0095:Col6a4 UTSW 9 106075356 missense probably benign 0.03
R0230:Col6a4 UTSW 9 106072366 missense probably benign 0.11
R0359:Col6a4 UTSW 9 105997146 missense probably benign
R0415:Col6a4 UTSW 9 106075080 missense probably damaging 0.99
R0433:Col6a4 UTSW 9 106067994 missense probably damaging 0.99
R0450:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0469:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0490:Col6a4 UTSW 9 106013770 missense probably damaging 0.99
R0621:Col6a4 UTSW 9 106066791 missense probably damaging 0.97
R0667:Col6a4 UTSW 9 106029959 splice site probably benign
R0681:Col6a4 UTSW 9 106067144 nonsense probably null
R0690:Col6a4 UTSW 9 106028187 splice site probably benign
R0714:Col6a4 UTSW 9 106017903 unclassified probably benign
R0788:Col6a4 UTSW 9 106071998 missense probably benign 0.15
R1036:Col6a4 UTSW 9 106068198 missense probably damaging 1.00
R1296:Col6a4 UTSW 9 106062853 missense possibly damaging 0.47
R1386:Col6a4 UTSW 9 106062945 missense probably benign 0.15
R1484:Col6a4 UTSW 9 106013302 critical splice donor site probably null
R1528:Col6a4 UTSW 9 106075220 missense probably damaging 0.99
R1555:Col6a4 UTSW 9 106000886 missense possibly damaging 0.93
R1622:Col6a4 UTSW 9 105997135 missense probably benign 0.01
R1653:Col6a4 UTSW 9 106072409 missense probably damaging 0.99
R1720:Col6a4 UTSW 9 106026472 missense probably damaging 1.00
R1768:Col6a4 UTSW 9 106080100 missense probably benign
R1941:Col6a4 UTSW 9 106075010 missense probably benign 0.00
R2092:Col6a4 UTSW 9 106060331 missense probably damaging 1.00
R2134:Col6a4 UTSW 9 106066661 missense probably benign 0.09
R2149:Col6a4 UTSW 9 106076929 missense probably benign 0.00
R2174:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2204:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2248:Col6a4 UTSW 9 106079959 missense probably benign 0.15
R2568:Col6a4 UTSW 9 106063076 missense possibly damaging 0.90
R3750:Col6a4 UTSW 9 106020665 critical splice acceptor site probably null
R3751:Col6a4 UTSW 9 106072114 missense probably damaging 0.98
R3776:Col6a4 UTSW 9 106051701 nonsense probably null
R3872:Col6a4 UTSW 9 106013659 missense possibly damaging 0.95
R4043:Col6a4 UTSW 9 106072411 nonsense probably null
R4056:Col6a4 UTSW 9 106026466 missense probably damaging 0.98
R4212:Col6a4 UTSW 9 106075370 missense probably benign 0.28
R4417:Col6a4 UTSW 9 106072016 missense probably damaging 0.99
R4683:Col6a4 UTSW 9 106080130 missense probably benign 0.00
R4719:Col6a4 UTSW 9 106068252 missense probably damaging 0.99
R4791:Col6a4 UTSW 9 106080202 missense possibly damaging 0.68
R4833:Col6a4 UTSW 9 106071979 missense probably benign 0.00
R4886:Col6a4 UTSW 9 106060072 missense probably benign 0.00
R4998:Col6a4 UTSW 9 105990778 utr 3 prime probably benign
R5091:Col6a4 UTSW 9 106075063 missense probably damaging 1.00
R5113:Col6a4 UTSW 9 106066960 missense possibly damaging 0.89
R5129:Col6a4 UTSW 9 106013377 missense probably damaging 0.98
R5231:Col6a4 UTSW 9 106025531 missense probably damaging 0.96
R5297:Col6a4 UTSW 9 106074867 missense probably benign 0.02
R5352:Col6a4 UTSW 9 106061544 missense probably damaging 1.00
R5438:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5518:Col6a4 UTSW 9 106072188 missense possibly damaging 0.68
R5657:Col6a4 UTSW 9 106072198 missense probably damaging 0.99
R5660:Col6a4 UTSW 9 105996116 missense probably benign 0.01
R5662:Col6a4 UTSW 9 106068001 missense probably damaging 0.99
R5777:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5800:Col6a4 UTSW 9 106080275 missense probably damaging 0.99
R5929:Col6a4 UTSW 9 106063044 missense probably benign 0.15
R5999:Col6a4 UTSW 9 106067921 missense probably benign 0.11
R6243:Col6a4 UTSW 9 106013390 missense possibly damaging 0.95
R6285:Col6a4 UTSW 9 106074986 missense probably damaging 0.96
R6288:Col6a4 UTSW 9 106068263 missense probably damaging 0.99
R6361:Col6a4 UTSW 9 106066703 missense probably benign 0.28
R6490:Col6a4 UTSW 9 106074992 nonsense probably null
R6537:Col6a4 UTSW 9 106067954 missense possibly damaging 0.87
R6598:Col6a4 UTSW 9 106000412 missense probably damaging 0.99
R6643:Col6a4 UTSW 9 106000631 missense probably damaging 0.96
R6905:Col6a4 UTSW 9 106060318 splice site probably null
R6944:Col6a4 UTSW 9 106072171 missense probably damaging 0.98
R7015:Col6a4 UTSW 9 106033755 critical splice donor site probably null
R7027:Col6a4 UTSW 9 106067014 missense probably damaging 1.00
R7088:Col6a4 UTSW 9 106000686 missense possibly damaging 0.56
R7200:Col6a4 UTSW 9 106072249 missense possibly damaging 0.68
R7238:Col6a4 UTSW 9 106000320 missense probably damaging 0.99
R7273:Col6a4 UTSW 9 106000457 missense possibly damaging 0.92
R7335:Col6a4 UTSW 9 106076892 missense possibly damaging 0.90
X0025:Col6a4 UTSW 9 106000455 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGATAAGTGGCAGATGTACG -3'
(R):5'- AAAGAGACGGGGTCTTTGTG -3'

Sequencing Primer
(F):5'- TAAAAGTATGACTTCTCTACCCCAG -3'
(R):5'- GTTTGTGGTAGGGATCAATATTCAAG -3'
Posted On2018-05-21