Incidental Mutation 'R6486:Trp63'
ID 517349
Institutional Source Beutler Lab
Gene Symbol Trp63
Ensembl Gene ENSMUSG00000022510
Gene Name transformation related protein 63
Synonyms p73L, deltaNp63, TAp63, p63, Trp53rp1, KET protein, p51/p63
MMRRC Submission 044618-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.868) question?
Stock # R6486 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 25502513-25710838 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25684090 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 326 (T326S)
Ref Sequence ENSEMBL: ENSMUSP00000110965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040231] [ENSMUST00000065523] [ENSMUST00000115304] [ENSMUST00000115305] [ENSMUST00000115306] [ENSMUST00000115308] [ENSMUST00000115310]
AlphaFold O88898
Predicted Effect probably damaging
Transcript: ENSMUST00000040231
AA Change: T232S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038117
Gene: ENSMUSG00000022510
AA Change: T232S

DomainStartEndE-ValueType
Pfam:P53 69 265 5.4e-110 PFAM
Pfam:P53_tetramer 297 338 2.4e-20 PFAM
low complexity region 343 356 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
SAM 447 513 1.4e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065523
AA Change: T326S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067005
Gene: ENSMUSG00000022510
AA Change: T326S

DomainStartEndE-ValueType
Pfam:P53 163 359 4.9e-110 PFAM
Pfam:P53_tetramer 391 432 2.2e-20 PFAM
low complexity region 437 450 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115304
AA Change: T232S

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110959
Gene: ENSMUSG00000022510
AA Change: T232S

DomainStartEndE-ValueType
Pfam:P53 69 265 1.5e-111 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115305
AA Change: T232S

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110960
Gene: ENSMUSG00000022510
AA Change: T232S

DomainStartEndE-ValueType
Pfam:P53 69 265 1.1e-110 PFAM
Pfam:P53_tetramer 297 338 5.5e-21 PFAM
low complexity region 343 358 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115306
AA Change: T232S

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110961
Gene: ENSMUSG00000022510
AA Change: T232S

DomainStartEndE-ValueType
Pfam:P53 69 265 2.7e-110 PFAM
Pfam:P53_tetramer 293 334 9.2e-21 PFAM
low complexity region 339 352 N/A INTRINSIC
low complexity region 354 365 N/A INTRINSIC
SAM 443 509 1.4e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115308
AA Change: T326S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110963
Gene: ENSMUSG00000022510
AA Change: T326S

DomainStartEndE-ValueType
Pfam:P53 163 359 3.6e-110 PFAM
Pfam:P53_tetramer 387 428 1.8e-20 PFAM
low complexity region 433 448 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115310
AA Change: T326S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110965
Gene: ENSMUSG00000022510
AA Change: T326S

DomainStartEndE-ValueType
Pfam:P53 163 359 1.3e-112 PFAM
Pfam:P53_tetramer 391 431 7e-21 PFAM
low complexity region 437 450 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
SAM 541 607 1.4e-7 SMART
Meta Mutation Damage Score 0.9418 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: This gene encodes tumor protein p63, a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include tumor proteins p53, p63, and p73, which have high sequence similarity to one another. This similarity allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways, including direct and indirect protein interactions. This results in mutual regulation of target gene promoters. Tumor protein p63 -/- mice have several developmental defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Both alternative splicing and the use of alternative promoters result in multiple transcript variants encoding different protein isoforms.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygotes for null mutations lack hair follicles, teeth, eyelids, and all squamous epithelia and derivatives including mammary, lacrymal, salivary, and prostate glands. Mutants have craniofacial anomalies, missing or truncated limbs, and small genitalia, and they die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1d T A 14: 29,836,190 (GRCm39) M853L probably benign Het
Cacna2d1 C T 5: 16,524,448 (GRCm39) probably null Het
Capg G T 6: 72,534,733 (GRCm39) E187* probably null Het
Carns1 C T 19: 4,219,979 (GRCm39) A419T probably benign Het
Cpt1b A G 15: 89,305,027 (GRCm39) M407T probably benign Het
Dlg2 A T 7: 91,521,582 (GRCm39) probably null Het
Ep400 T C 5: 110,845,084 (GRCm39) probably benign Het
Epha4 T C 1: 77,360,186 (GRCm39) N704D probably damaging Het
Gga2 A G 7: 121,601,411 (GRCm39) S231P probably damaging Het
Gpbp1l1 A G 4: 116,438,572 (GRCm39) K223E probably damaging Het
Homer1 A T 13: 93,528,233 (GRCm39) N78I possibly damaging Het
Lmbr1 C T 5: 29,528,859 (GRCm39) V122M probably damaging Het
Mpeg1 C A 19: 12,439,469 (GRCm39) A309E probably damaging Het
Myo18a A G 11: 77,755,648 (GRCm39) E1713G possibly damaging Het
Neto1 A G 18: 86,479,371 (GRCm39) I186M probably benign Het
Nfasc T C 1: 132,532,952 (GRCm39) D668G probably damaging Het
Nlrc5 T C 8: 95,247,927 (GRCm39) probably null Het
Or1j11 A T 2: 36,311,556 (GRCm39) I49F probably damaging Het
Or5b124 T G 19: 13,611,055 (GRCm39) N193K probably damaging Het
Or8c11 G A 9: 38,289,200 (GRCm39) V2I probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 (GRCm39) probably benign Het
Prkdc T C 16: 15,570,628 (GRCm39) S2304P probably damaging Het
Sgsm3 T C 15: 80,895,546 (GRCm39) I699T probably damaging Het
Slc8b1 T C 5: 120,671,067 (GRCm39) F551S probably damaging Het
Stra6 TC T 9: 58,058,705 (GRCm39) probably null Het
Tlr3 T C 8: 45,851,650 (GRCm39) probably null Het
Tnfrsf22 T C 7: 143,194,493 (GRCm39) T145A possibly damaging Het
Unc45a C G 7: 79,989,400 (GRCm39) E23Q probably benign Het
Vmn1r234 A T 17: 21,449,604 (GRCm39) M173L probably benign Het
Vmn2r13 T G 5: 109,304,425 (GRCm39) I669L probably benign Het
Vwa5a G A 9: 38,645,174 (GRCm39) G420R probably null Het
Other mutations in Trp63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00935:Trp63 APN 16 25,689,826 (GRCm39) missense probably damaging 1.00
IGL01402:Trp63 APN 16 25,639,135 (GRCm39) splice site probably benign
IGL01404:Trp63 APN 16 25,639,135 (GRCm39) splice site probably benign
IGL01874:Trp63 APN 16 25,701,335 (GRCm39) missense possibly damaging 0.88
IGL01887:Trp63 APN 16 25,684,069 (GRCm39) missense probably damaging 1.00
IGL02008:Trp63 APN 16 25,681,211 (GRCm39) missense probably damaging 1.00
IGL02336:Trp63 APN 16 25,639,192 (GRCm39) missense probably damaging 1.00
IGL02470:Trp63 APN 16 25,639,134 (GRCm39) splice site probably benign
IGL02720:Trp63 APN 16 25,682,491 (GRCm39) missense probably damaging 0.96
IGL03230:Trp63 APN 16 25,707,760 (GRCm39) missense probably damaging 1.00
PIT4142001:Trp63 UTSW 16 25,684,013 (GRCm39) missense probably damaging 1.00
R0086:Trp63 UTSW 16 25,689,837 (GRCm39) missense probably damaging 1.00
R0281:Trp63 UTSW 16 25,583,052 (GRCm39) splice site probably benign
R1448:Trp63 UTSW 16 25,707,870 (GRCm39) missense possibly damaging 0.67
R1517:Trp63 UTSW 16 25,708,003 (GRCm39) missense probably damaging 1.00
R1539:Trp63 UTSW 16 25,703,599 (GRCm39) missense probably benign 0.02
R3922:Trp63 UTSW 16 25,707,759 (GRCm39) missense probably damaging 1.00
R3977:Trp63 UTSW 16 25,639,490 (GRCm39) intron probably benign
R3978:Trp63 UTSW 16 25,639,490 (GRCm39) intron probably benign
R3979:Trp63 UTSW 16 25,639,490 (GRCm39) intron probably benign
R4689:Trp63 UTSW 16 25,684,012 (GRCm39) missense possibly damaging 0.90
R4870:Trp63 UTSW 16 25,684,968 (GRCm39) makesense probably null
R5009:Trp63 UTSW 16 25,686,977 (GRCm39) missense probably damaging 0.99
R5033:Trp63 UTSW 16 25,582,056 (GRCm39) missense probably damaging 0.99
R5058:Trp63 UTSW 16 25,701,344 (GRCm39) missense probably damaging 1.00
R5118:Trp63 UTSW 16 25,707,760 (GRCm39) missense unknown
R5354:Trp63 UTSW 16 25,503,105 (GRCm39) splice site probably null
R5363:Trp63 UTSW 16 25,682,468 (GRCm39) missense probably damaging 0.99
R5668:Trp63 UTSW 16 25,684,935 (GRCm39) missense possibly damaging 0.52
R6004:Trp63 UTSW 16 25,582,146 (GRCm39) critical splice donor site probably null
R6029:Trp63 UTSW 16 25,686,964 (GRCm39) missense probably damaging 1.00
R6170:Trp63 UTSW 16 25,703,603 (GRCm39) missense probably benign 0.28
R6186:Trp63 UTSW 16 25,695,483 (GRCm39) intron probably benign
R6266:Trp63 UTSW 16 25,681,210 (GRCm39) missense probably damaging 0.99
R6466:Trp63 UTSW 16 25,582,108 (GRCm39) missense probably damaging 1.00
R6913:Trp63 UTSW 16 25,707,918 (GRCm39) missense probably damaging 1.00
R6980:Trp63 UTSW 16 25,620,843 (GRCm39) missense probably benign
R7097:Trp63 UTSW 16 25,639,227 (GRCm39) missense probably damaging 1.00
R7122:Trp63 UTSW 16 25,639,227 (GRCm39) missense probably damaging 1.00
R7544:Trp63 UTSW 16 25,620,837 (GRCm39) missense probably benign
R7690:Trp63 UTSW 16 25,695,483 (GRCm39) missense unknown
R7743:Trp63 UTSW 16 25,701,375 (GRCm39) missense probably benign 0.05
R7766:Trp63 UTSW 16 25,686,969 (GRCm39) missense probably damaging 0.97
R7792:Trp63 UTSW 16 25,686,974 (GRCm39) missense possibly damaging 0.94
R7816:Trp63 UTSW 16 25,707,990 (GRCm39) missense probably damaging 1.00
R7978:Trp63 UTSW 16 25,639,436 (GRCm39) missense unknown
R8324:Trp63 UTSW 16 25,695,484 (GRCm39) missense unknown
R8857:Trp63 UTSW 16 25,639,226 (GRCm39) missense probably damaging 1.00
R9041:Trp63 UTSW 16 25,582,083 (GRCm39) missense probably benign
R9123:Trp63 UTSW 16 25,639,247 (GRCm39) missense probably damaging 1.00
R9491:Trp63 UTSW 16 25,695,472 (GRCm39) missense unknown
R9642:Trp63 UTSW 16 25,682,508 (GRCm39) missense probably benign 0.35
Z1088:Trp63 UTSW 16 25,582,063 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AACATGCCATTTGAAGTGGAGTTC -3'
(R):5'- TGTTTACAAGGGATTTGCAGCTC -3'

Sequencing Primer
(F):5'- CCATTTGAAGTGGAGTTCTGGAG -3'
(R):5'- CAAAGCACTGAATCTGGGTCTTC -3'
Posted On 2018-05-21