Mutagenetix > Incidental Mutation

Incidental Mutation 'R6475:Cd209a'

517381

Institutional Source

Beutler Lab

Gene Symbol

Cd209a

Ensembl Gene

ENSMUSG00000031494

Gene Name

CD209a antigen

Synonyms

CIRE, Dcsign, DC-SIGN, SIGNR5, CD209, DC-SIGN1

MMRRC Submission

044608-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6475 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3793397-3798984 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 3797031 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 102 (D102E)

Ref Sequence

ENSEMBL: ENSMUSP00000012847 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000012847] [ENSMUST00000207979] [ENSMUST00000208960]

AlphaFold

Q91ZX1

Predicted Effect

probably damaging
Transcript: ENSMUST00000012847
AA Change: D102E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000012847
Gene: ENSMUSG00000031494
AA Change: D102E

Domain	Start	End	E-Value	Type
transmembrane domain	54	76	N/A	INTRINSIC
CLECT	108	229	2.79e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207906

Predicted Effect

probably benign
Transcript: ENSMUST00000207979
AA Change: D75E

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000208960
AA Change: D43E

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.0%

Validation Efficiency

96% (54/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane receptor and is often referred to as L-SIGN because of its expression in the endothelial cells of the lymph nodes and liver. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses, with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are common and have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 30835; often referred to as DC-SIGN or CD209). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to bacterial infection despite altered lymphocyte numbers and increased inflammatory response.. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asb5	T	A	8: 55,003,610 (GRCm39)	V44E	probably damaging	Het
Bmpr2	T	A	1: 59,907,503 (GRCm39)	D865E	probably damaging	Het
Ccr4	A	G	9: 114,322,047 (GRCm39)	V6A	probably benign	Het
Cdh18	A	G	15: 23,227,022 (GRCm39)	D161G	possibly damaging	Het
Cog4	T	A	8: 111,607,526 (GRCm39)	I671N	possibly damaging	Het
Col14a1	T	G	15: 55,309,218 (GRCm39)		probably benign	Het
Cpne6	A	G	14: 55,751,110 (GRCm39)	D173G	probably damaging	Het
Daglb	G	T	5: 143,467,406 (GRCm39)	V275L	probably benign	Het
Defb43	G	T	14: 63,249,321 (GRCm39)		probably null	Het
Dhx30	A	G	9: 109,914,120 (GRCm39)	V1022A	possibly damaging	Het
Egfem1	A	T	3: 29,711,312 (GRCm39)	K297M	probably damaging	Het
Egfr	A	G	11: 16,841,259 (GRCm39)	I717V	probably benign	Het
Eif2ak1	T	G	5: 143,803,765 (GRCm39)		probably null	Het
Epb42	T	C	2: 120,857,614 (GRCm39)	Y307C	possibly damaging	Het
Erlec1	G	A	11: 30,898,442 (GRCm39)	Q10*	probably null	Het
Fam185a	A	G	5: 21,630,281 (GRCm39)	D39G	probably benign	Het
Fbxl4	T	A	4: 22,433,661 (GRCm39)	D599E	probably damaging	Het
Fgfr2	T	A	7: 129,802,850 (GRCm39)	T268S	probably benign	Het
Gabra1	A	T	11: 42,053,382 (GRCm39)	M84K	probably benign	Het
Gba1	A	G	3: 89,113,235 (GRCm39)	D222G	probably benign	Het
Gm3409	T	A	5: 146,474,596 (GRCm39)	H37Q	possibly damaging	Het
Gm4559	A	G	7: 141,827,887 (GRCm39)	C72R	unknown	Het
Grik4	T	C	9: 42,540,304 (GRCm39)	N292S	probably benign	Het
Haao	A	G	17: 84,139,113 (GRCm39)	S274P	possibly damaging	Het
Hsd17b4	T	A	18: 50,305,329 (GRCm39)		probably null	Het
Igdcc4	A	T	9: 65,027,603 (GRCm39)	S222C	probably damaging	Het
Iqub	T	A	6: 24,449,744 (GRCm39)	N707I	probably damaging	Het
Itgb7	T	A	15: 102,124,701 (GRCm39)	D772V	probably benign	Het
Kif14	T	C	1: 136,455,149 (GRCm39)	L1607P	probably damaging	Het
Klf5	A	G	14: 99,538,817 (GRCm39)	T77A	probably benign	Het
Klhl29	C	T	12: 5,141,030 (GRCm39)	V605I	probably damaging	Het
Map4k1	T	C	7: 28,686,447 (GRCm39)	V105A	probably damaging	Het
Mctp2	A	T	7: 71,850,092 (GRCm39)		probably null	Het
Med12l	A	G	3: 59,164,500 (GRCm39)	E1364G	probably damaging	Het
Mup9	A	T	4: 60,375,805 (GRCm39)	D30E	possibly damaging	Het
Naip1	T	C	13: 100,545,596 (GRCm39)	R1311G	probably damaging	Het
Or2ag2	A	G	7: 106,485,604 (GRCm39)	V140A	probably benign	Het
Or2v1	C	T	11: 49,025,760 (GRCm39)	T247I	probably benign	Het
Or4f14	G	A	2: 111,743,204 (GRCm39)	Q24*	probably null	Het
Or8g28	T	A	9: 39,169,378 (GRCm39)	M197L	probably benign	Het
Pkd1l3	A	C	8: 110,349,844 (GRCm39)	T230P	unknown	Het
Pthlh	G	T	6: 147,158,688 (GRCm39)	H91N	probably damaging	Het
Rapgef5	T	A	12: 117,681,942 (GRCm39)	V239D	probably damaging	Het
Rita1	G	A	5: 120,749,635 (GRCm39)	T26I	probably damaging	Het
Robo3	T	C	9: 37,334,586 (GRCm39)	T615A	probably damaging	Het
Rpp38	T	C	2: 3,330,644 (GRCm39)	D86G	probably benign	Het
Sec31a	T	C	5: 100,533,129 (GRCm39)	T539A	probably damaging	Het
Senp2	G	T	16: 21,842,550 (GRCm39)	V205L	probably damaging	Het
Septin10	T	C	10: 59,028,133 (GRCm39)	N63D	possibly damaging	Het
Sez6	A	G	11: 77,864,670 (GRCm39)			Het
Spesp1	C	T	9: 62,179,715 (GRCm39)	V398I	probably benign	Het
Tmbim7	G	A	5: 3,714,319 (GRCm39)	G19S	probably benign	Het
Tnni3k	A	T	3: 154,646,695 (GRCm39)	L431*	probably null	Het
Trdn	T	A	10: 33,340,551 (GRCm39)		probably null	Het
Tubb2a	A	G	13: 34,259,442 (GRCm39)	V116A	possibly damaging	Het
Ush1c	T	C	7: 45,878,643 (GRCm39)	D124G	probably damaging	Het
Zfp768	A	T	7: 126,943,827 (GRCm39)	F103L	probably damaging	Het
Zfp799	A	G	17: 33,039,820 (GRCm39)	S149P	probably damaging	Het

Other mutations in Cd209a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01823:Cd209a	APN	8	3,798,851 (GRCm39)	splice site	probably benign
IGL02216:Cd209a	APN	8	3,795,576 (GRCm39)	missense	probably damaging	1.00
R0306:Cd209a	UTSW	8	3,795,535 (GRCm39)	missense	probably benign
R0696:Cd209a	UTSW	8	3,798,384 (GRCm39)	missense	possibly damaging	0.65
R1818:Cd209a	UTSW	8	3,795,576 (GRCm39)	missense	probably damaging	0.99
R4517:Cd209a	UTSW	8	3,795,525 (GRCm39)	missense	probably damaging	1.00
R4994:Cd209a	UTSW	8	3,797,713 (GRCm39)	critical splice acceptor site	probably null
R5913:Cd209a	UTSW	8	3,798,742 (GRCm39)	missense	probably benign	0.00
R7372:Cd209a	UTSW	8	3,798,857 (GRCm39)	splice site	probably null
R7557:Cd209a	UTSW	8	3,795,541 (GRCm39)	missense	probably benign	0.11
R7570:Cd209a	UTSW	8	3,794,151 (GRCm39)	missense	probably damaging	1.00
R8898:Cd209a	UTSW	8	3,798,739 (GRCm39)	missense	probably damaging	1.00
R9165:Cd209a	UTSW	8	3,795,602 (GRCm39)	missense	probably damaging	1.00
Z1088:Cd209a	UTSW	8	3,797,017 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGTATCCTTGATGGGCCTCAC -3'
(R):5'- CTCAGTTAAACCAGCCTCCTG -3'

Sequencing Primer
(F):5'- GGCAGAATCATTCCAGGA -3'
(R):5'- GAGCTCTAAGACCAAACTTTTTCCAG -3'

Posted On

2018-05-21