Incidental Mutation 'R6475:Cpne6'
ID517401
Institutional Source Beutler Lab
Gene Symbol Cpne6
Ensembl Gene ENSMUSG00000022212
Gene Namecopine VI
Synonymsneuronal copine
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R6475 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55510445-55517431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55513653 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 173 (D173G)
Ref Sequence ENSEMBL: ENSMUSP00000128555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074225] [ENSMUST00000163767] [ENSMUST00000165262] [ENSMUST00000165725] [ENSMUST00000171643]
Predicted Effect probably damaging
Transcript: ENSMUST00000074225
AA Change: D173G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073847
Gene: ENSMUSG00000022212
AA Change: D173G

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163767
AA Change: D173G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126493
Gene: ENSMUSG00000022212
AA Change: D173G

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165262
AA Change: D173G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132999
Gene: ENSMUSG00000022212
AA Change: D173G

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 505 2.34e-14 SMART
low complexity region 542 556 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165725
SMART Domains Protein: ENSMUSP00000130799
Gene: ENSMUSG00000022212

DomainStartEndE-ValueType
C2 21 126 1.22e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170155
Predicted Effect probably damaging
Transcript: ENSMUST00000171643
AA Change: D173G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128555
Gene: ENSMUSG00000022212
AA Change: D173G

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encodes a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb5 T A 8: 54,550,575 V44E probably damaging Het
Bmpr2 T A 1: 59,868,344 D865E probably damaging Het
Ccr4 A G 9: 114,492,979 V6A probably benign Het
Cd209a A T 8: 3,747,031 D102E probably damaging Het
Cdh18 A G 15: 23,226,936 D161G possibly damaging Het
Cog4 T A 8: 110,880,894 I671N possibly damaging Het
Col14a1 T G 15: 55,445,822 probably benign Het
Daglb G T 5: 143,481,651 V275L probably benign Het
Defb43 G T 14: 63,011,872 probably null Het
Dhx30 A G 9: 110,085,052 V1022A possibly damaging Het
Egfem1 A T 3: 29,657,163 K297M probably damaging Het
Egfr A G 11: 16,891,259 I717V probably benign Het
Eif2ak1 T G 5: 143,818,010 probably null Het
Epb42 T C 2: 121,027,133 Y307C possibly damaging Het
Erlec1 G A 11: 30,948,442 Q10* probably null Het
Fam185a A G 5: 21,425,283 D39G probably benign Het
Fbxl4 T A 4: 22,433,661 D599E probably damaging Het
Fgfr2 T A 7: 130,201,120 T268S probably benign Het
Gabra1 A T 11: 42,162,555 M84K probably benign Het
Gba A G 3: 89,205,928 D222G probably benign Het
Gm3409 T A 5: 146,537,786 H37Q possibly damaging Het
Gm4559 A G 7: 142,274,150 C72R unknown Het
Grik4 T C 9: 42,629,008 N292S probably benign Het
Haao A G 17: 83,831,684 S274P possibly damaging Het
Hsd17b4 T A 18: 50,172,262 probably null Het
Igdcc4 A T 9: 65,120,321 S222C probably damaging Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Itgb7 T A 15: 102,216,266 D772V probably benign Het
Kif14 T C 1: 136,527,411 L1607P probably damaging Het
Klf5 A G 14: 99,301,381 T77A probably benign Het
Klhl29 C T 12: 5,091,030 V605I probably damaging Het
Map4k1 T C 7: 28,987,022 V105A probably damaging Het
Mctp2 A T 7: 72,200,344 probably null Het
Med12l A G 3: 59,257,079 E1364G probably damaging Het
Mup9 A T 4: 60,419,806 D30E possibly damaging Het
Naip1 T C 13: 100,409,088 R1311G probably damaging Het
Olfr1306 G A 2: 111,912,859 Q24* probably null Het
Olfr56 C T 11: 49,134,933 T247I probably benign Het
Olfr706 A G 7: 106,886,397 V140A probably benign Het
Olfr945 T A 9: 39,258,082 M197L probably benign Het
Pkd1l3 A C 8: 109,623,212 T230P unknown Het
Pthlh G T 6: 147,257,190 H91N probably damaging Het
Rapgef5 T A 12: 117,718,207 V239D probably damaging Het
Rita1 G A 5: 120,611,570 T26I probably damaging Het
Robo3 T C 9: 37,423,290 T615A probably damaging Het
Rpp38 T C 2: 3,329,607 D86G probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Senp2 G T 16: 22,023,800 V205L probably damaging Het
Sept10 T C 10: 59,192,311 N63D possibly damaging Het
Sez6 A G 11: 77,973,844 Het
Spesp1 C T 9: 62,272,433 V398I probably benign Het
Tmbim7 G A 5: 3,664,319 G19S probably benign Het
Tnni3k A T 3: 154,941,058 L431* probably null Het
Trdn T A 10: 33,464,555 probably null Het
Tubb2a A G 13: 34,075,459 V116A possibly damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Zfp768 A T 7: 127,344,655 F103L probably damaging Het
Zfp799 A G 17: 32,820,846 S149P probably damaging Het
Other mutations in Cpne6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Cpne6 APN 14 55512730 missense probably damaging 1.00
IGL01306:Cpne6 APN 14 55515249 missense probably damaging 1.00
IGL01548:Cpne6 APN 14 55512726 missense probably damaging 0.99
IGL01867:Cpne6 APN 14 55513680 missense probably benign 0.16
IGL01902:Cpne6 APN 14 55512750 missense possibly damaging 0.80
IGL02669:Cpne6 APN 14 55513826 missense probably benign 0.09
IGL02695:Cpne6 APN 14 55514580 missense probably damaging 1.00
IGL03082:Cpne6 APN 14 55516303 missense probably damaging 1.00
ANU23:Cpne6 UTSW 14 55512002 missense probably benign 0.05
ANU23:Cpne6 UTSW 14 55515249 missense probably damaging 1.00
R0504:Cpne6 UTSW 14 55514602 missense probably damaging 0.99
R1472:Cpne6 UTSW 14 55514635 missense probably benign 0.00
R1538:Cpne6 UTSW 14 55515220 missense possibly damaging 0.92
R1898:Cpne6 UTSW 14 55517028 missense possibly damaging 0.88
R2679:Cpne6 UTSW 14 55516329 missense possibly damaging 0.94
R4235:Cpne6 UTSW 14 55513600 intron probably benign
R4453:Cpne6 UTSW 14 55512597 missense probably damaging 1.00
R4471:Cpne6 UTSW 14 55516632 missense probably damaging 1.00
R4823:Cpne6 UTSW 14 55517010 missense probably damaging 1.00
R5171:Cpne6 UTSW 14 55512148 missense possibly damaging 0.71
R5243:Cpne6 UTSW 14 55512747 missense probably damaging 1.00
R5999:Cpne6 UTSW 14 55513059 missense probably benign
R6111:Cpne6 UTSW 14 55514634 missense probably benign 0.18
R6535:Cpne6 UTSW 14 55513665 missense probably benign 0.30
R6787:Cpne6 UTSW 14 55515244 missense probably damaging 1.00
R7318:Cpne6 UTSW 14 55514294 missense possibly damaging 0.95
R7453:Cpne6 UTSW 14 55512016 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATCCACGCCCCATTAGAGAG -3'
(R):5'- ATGCTCCAGGGCTTTACCTTG -3'

Sequencing Primer
(F):5'- GCCCCATTAGAGAGAGCCATAG -3'
(R):5'- TGGATGTCACAGCTGCAC -3'
Posted On2018-05-21