Incidental Mutation 'R6475:Col14a1'
ID517404
Institutional Source Beutler Lab
Gene Symbol Col14a1
Ensembl Gene ENSMUSG00000022371
Gene Namecollagen, type XIV, alpha 1
Synonyms5730412L22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6475 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location55307750-55520803 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to G at 55445822 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023053] [ENSMUST00000110217] [ENSMUST00000110221]
Predicted Effect unknown
Transcript: ENSMUST00000023053
AA Change: I1101S
SMART Domains Protein: ENSMUSP00000023053
Gene: ENSMUSG00000022371
AA Change: I1101S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 818 6.2e-7 SMART
FN3 830 909 1.45e-7 SMART
FN3 920 999 3.59e0 SMART
low complexity region 1010 1022 N/A INTRINSIC
VWA 1031 1211 2.02e-59 SMART
TSPN 1230 1425 1.19e-66 SMART
Pfam:Collagen 1461 1515 2.9e-8 PFAM
Pfam:Collagen 1513 1571 6.3e-9 PFAM
Pfam:Collagen 1555 1615 8.5e-10 PFAM
Pfam:Collagen 1653 1709 7.6e-10 PFAM
Pfam:Collagen 1707 1762 2.6e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110217
AA Change: I1102S
SMART Domains Protein: ENSMUSP00000105846
Gene: ENSMUSG00000022371
AA Change: I1102S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 819 5.4e-7 SMART
FN3 831 910 1.45e-7 SMART
FN3 921 1000 3.59e0 SMART
low complexity region 1011 1023 N/A INTRINSIC
VWA 1032 1212 2.02e-59 SMART
TSPN 1231 1426 1.19e-66 SMART
Pfam:Collagen 1462 1516 2.5e-8 PFAM
Pfam:Collagen 1514 1572 5.4e-9 PFAM
Pfam:Collagen 1556 1616 7.3e-10 PFAM
Pfam:Collagen 1654 1710 6.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110221
AA Change: I1098S
SMART Domains Protein: ENSMUSP00000105850
Gene: ENSMUSG00000022371
AA Change: I1098S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 815 7.12e-7 SMART
FN3 827 906 1.45e-7 SMART
FN3 917 996 3.59e0 SMART
low complexity region 1007 1019 N/A INTRINSIC
VWA 1028 1208 2.02e-59 SMART
TSPN 1227 1422 1.19e-66 SMART
Pfam:Collagen 1458 1512 8.2e-9 PFAM
Pfam:Collagen 1510 1568 1.8e-9 PFAM
Pfam:Collagen 1552 1612 2.4e-10 PFAM
Pfam:Collagen 1650 1706 2.2e-10 PFAM
Pfam:Collagen 1704 1759 7.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125416
SMART Domains Protein: ENSMUSP00000122455
Gene: ENSMUSG00000022371

DomainStartEndE-ValueType
TSPN 2 165 2.04e-42 SMART
Pfam:Collagen 201 255 2.1e-9 PFAM
Pfam:Collagen 253 305 3.3e-9 PFAM
Pfam:Collagen 295 355 4.4e-11 PFAM
Pfam:Collagen 393 448 5.7e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIV collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XIV collagen interacts with the fibril surface and is involved in the regulation of fibrillogenesis. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null mutation display abnormal tendon morphology and abnormal biomechanical properties of the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb5 T A 8: 54,550,575 V44E probably damaging Het
Bmpr2 T A 1: 59,868,344 D865E probably damaging Het
Ccr4 A G 9: 114,492,979 V6A probably benign Het
Cd209a A T 8: 3,747,031 D102E probably damaging Het
Cdh18 A G 15: 23,226,936 D161G possibly damaging Het
Cog4 T A 8: 110,880,894 I671N possibly damaging Het
Cpne6 A G 14: 55,513,653 D173G probably damaging Het
Daglb G T 5: 143,481,651 V275L probably benign Het
Defb43 G T 14: 63,011,872 probably null Het
Dhx30 A G 9: 110,085,052 V1022A possibly damaging Het
Egfem1 A T 3: 29,657,163 K297M probably damaging Het
Egfr A G 11: 16,891,259 I717V probably benign Het
Eif2ak1 T G 5: 143,818,010 probably null Het
Epb42 T C 2: 121,027,133 Y307C possibly damaging Het
Erlec1 G A 11: 30,948,442 Q10* probably null Het
Fam185a A G 5: 21,425,283 D39G probably benign Het
Fbxl4 T A 4: 22,433,661 D599E probably damaging Het
Fgfr2 T A 7: 130,201,120 T268S probably benign Het
Gabra1 A T 11: 42,162,555 M84K probably benign Het
Gba A G 3: 89,205,928 D222G probably benign Het
Gm3409 T A 5: 146,537,786 H37Q possibly damaging Het
Gm4559 A G 7: 142,274,150 C72R unknown Het
Grik4 T C 9: 42,629,008 N292S probably benign Het
Haao A G 17: 83,831,684 S274P possibly damaging Het
Hsd17b4 T A 18: 50,172,262 probably null Het
Igdcc4 A T 9: 65,120,321 S222C probably damaging Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Itgb7 T A 15: 102,216,266 D772V probably benign Het
Kif14 T C 1: 136,527,411 L1607P probably damaging Het
Klf5 A G 14: 99,301,381 T77A probably benign Het
Klhl29 C T 12: 5,091,030 V605I probably damaging Het
Map4k1 T C 7: 28,987,022 V105A probably damaging Het
Mctp2 A T 7: 72,200,344 probably null Het
Med12l A G 3: 59,257,079 E1364G probably damaging Het
Mup9 A T 4: 60,419,806 D30E possibly damaging Het
Naip1 T C 13: 100,409,088 R1311G probably damaging Het
Olfr1306 G A 2: 111,912,859 Q24* probably null Het
Olfr56 C T 11: 49,134,933 T247I probably benign Het
Olfr706 A G 7: 106,886,397 V140A probably benign Het
Olfr945 T A 9: 39,258,082 M197L probably benign Het
Pkd1l3 A C 8: 109,623,212 T230P unknown Het
Pthlh G T 6: 147,257,190 H91N probably damaging Het
Rapgef5 T A 12: 117,718,207 V239D probably damaging Het
Rita1 G A 5: 120,611,570 T26I probably damaging Het
Robo3 T C 9: 37,423,290 T615A probably damaging Het
Rpp38 T C 2: 3,329,607 D86G probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Senp2 G T 16: 22,023,800 V205L probably damaging Het
Sept10 T C 10: 59,192,311 N63D possibly damaging Het
Sez6 A G 11: 77,973,844 Het
Spesp1 C T 9: 62,272,433 V398I probably benign Het
Tmbim7 G A 5: 3,664,319 G19S probably benign Het
Tnni3k A T 3: 154,941,058 L431* probably null Het
Trdn T A 10: 33,464,555 probably null Het
Tubb2a A G 13: 34,075,459 V116A possibly damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Zfp768 A T 7: 127,344,655 F103L probably damaging Het
Zfp799 A G 17: 32,820,846 S149P probably damaging Het
Other mutations in Col14a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Col14a1 APN 15 55411585 missense unknown
IGL01290:Col14a1 APN 15 55423507 missense unknown
IGL01300:Col14a1 APN 15 55467976 missense unknown
IGL01505:Col14a1 APN 15 55455223 missense unknown
IGL01533:Col14a1 APN 15 55420840 missense unknown
IGL01563:Col14a1 APN 15 55487941 missense unknown
IGL01650:Col14a1 APN 15 55406693 missense unknown
IGL01659:Col14a1 APN 15 55446172 unclassified probably benign
IGL01670:Col14a1 APN 15 55329266 missense unknown
IGL01760:Col14a1 APN 15 55423459 missense unknown
IGL01803:Col14a1 APN 15 55418814 missense unknown
IGL01966:Col14a1 APN 15 55448725 unclassified probably benign
IGL01990:Col14a1 APN 15 55363463 missense unknown
IGL02124:Col14a1 APN 15 55463703 missense unknown
IGL02138:Col14a1 APN 15 55420835 missense unknown
IGL02192:Col14a1 APN 15 55362402 missense unknown
IGL02326:Col14a1 APN 15 55418797 missense unknown
IGL02335:Col14a1 APN 15 55463769 splice site probably benign
IGL02407:Col14a1 APN 15 55448876 splice site probably benign
IGL02486:Col14a1 APN 15 55388696 splice site probably benign
IGL02537:Col14a1 APN 15 55344914 nonsense probably null
IGL02567:Col14a1 APN 15 55344961 critical splice donor site probably null
IGL02643:Col14a1 APN 15 55420862 missense unknown
IGL02669:Col14a1 APN 15 55418782 missense unknown
IGL02673:Col14a1 APN 15 55418782 missense unknown
IGL02674:Col14a1 APN 15 55418782 missense unknown
IGL03201:Col14a1 APN 15 55408904 missense unknown
IGL03334:Col14a1 APN 15 55448821 unclassified probably benign
IGL03370:Col14a1 APN 15 55488541 splice site probably null
IGL03385:Col14a1 APN 15 55410204 missense unknown
IGL03385:Col14a1 APN 15 55471708 missense unknown
PIT4131001:Col14a1 UTSW 15 55448876 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0173:Col14a1 UTSW 15 55488532 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0359:Col14a1 UTSW 15 55407868 splice site probably benign
R0391:Col14a1 UTSW 15 55446259 unclassified probably benign
R0468:Col14a1 UTSW 15 55388646 missense unknown
R0652:Col14a1 UTSW 15 55344882 missense unknown
R0692:Col14a1 UTSW 15 55341738 missense unknown
R0745:Col14a1 UTSW 15 55338417 missense unknown
R1006:Col14a1 UTSW 15 55519935 missense probably benign 0.04
R1331:Col14a1 UTSW 15 55410188 missense unknown
R1537:Col14a1 UTSW 15 55380767 missense unknown
R1557:Col14a1 UTSW 15 55388579 missense unknown
R1721:Col14a1 UTSW 15 55447462 unclassified probably benign
R1737:Col14a1 UTSW 15 55344961 critical splice donor site probably benign
R1837:Col14a1 UTSW 15 55382495 missense unknown
R1867:Col14a1 UTSW 15 55447462 unclassified probably benign
R1868:Col14a1 UTSW 15 55447462 unclassified probably benign
R1991:Col14a1 UTSW 15 55449940 missense unknown
R2020:Col14a1 UTSW 15 55446181 unclassified probably benign
R2103:Col14a1 UTSW 15 55449940 missense unknown
R2116:Col14a1 UTSW 15 55407764 missense unknown
R2163:Col14a1 UTSW 15 55444645 unclassified probably benign
R2207:Col14a1 UTSW 15 55463686 missense unknown
R2215:Col14a1 UTSW 15 55380842 missense unknown
R2264:Col14a1 UTSW 15 55466690 splice site probably null
R2383:Col14a1 UTSW 15 55447517 unclassified probably benign
R2397:Col14a1 UTSW 15 55338439 missense unknown
R2422:Col14a1 UTSW 15 55449922 missense unknown
R3793:Col14a1 UTSW 15 55363513 missense unknown
R4082:Col14a1 UTSW 15 55437033 missense unknown
R4112:Col14a1 UTSW 15 55363559 missense unknown
R4519:Col14a1 UTSW 15 55388579 missense unknown
R4628:Col14a1 UTSW 15 55449833 nonsense probably null
R4692:Col14a1 UTSW 15 55423468 missense unknown
R4696:Col14a1 UTSW 15 55372602 missense unknown
R4749:Col14a1 UTSW 15 55452336 missense unknown
R5324:Col14a1 UTSW 15 55338445 missense unknown
R5382:Col14a1 UTSW 15 55362436 missense unknown
R5634:Col14a1 UTSW 15 55518298 missense probably damaging 1.00
R5781:Col14a1 UTSW 15 55423512 missense unknown
R5828:Col14a1 UTSW 15 55436976 missense unknown
R5873:Col14a1 UTSW 15 55445786 unclassified probably benign
R5966:Col14a1 UTSW 15 55452383 critical splice donor site probably null
R6106:Col14a1 UTSW 15 55520008 missense probably damaging 1.00
R6135:Col14a1 UTSW 15 55380850 missense unknown
R6319:Col14a1 UTSW 15 55516169 missense probably damaging 0.99
R6540:Col14a1 UTSW 15 55372581 missense unknown
R6893:Col14a1 UTSW 15 55444648 unclassified probably benign
X0023:Col14a1 UTSW 15 55423447 missense unknown
X0063:Col14a1 UTSW 15 55410215 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTATGGATGTGACAGTGCTTC -3'
(R):5'- AAATTACGTGTCCTGGGAGC -3'

Sequencing Primer
(F):5'- AGTGCTTCTGTGTCTTCTGAC -3'
(R):5'- GCAAGGTACCTGTGATGCG -3'
Posted On2018-05-21