Incidental Mutation 'R6458:Il18r1'
ID517409
Institutional Source Beutler Lab
Gene Symbol Il18r1
Ensembl Gene ENSMUSG00000026070
Gene Nameinterleukin 18 receptor 1
SynonymsIl18ralpha, Il1rrp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6458 (G1)
Quality Score215.009
Status Validated
Chromosome1
Chromosomal Location40465552-40500854 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 40491182 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 356 (Y356*)
Ref Sequence ENSEMBL: ENSMUSP00000142070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087983] [ENSMUST00000108044] [ENSMUST00000167723] [ENSMUST00000193391] [ENSMUST00000193793] [ENSMUST00000195684]
Predicted Effect probably null
Transcript: ENSMUST00000087983
AA Change: Y356*
SMART Domains Protein: ENSMUSP00000085298
Gene: ENSMUSG00000026070
AA Change: Y356*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108044
AA Change: Y356*
SMART Domains Protein: ENSMUSP00000103679
Gene: ENSMUSG00000026070
AA Change: Y356*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167723
AA Change: Y356*
SMART Domains Protein: ENSMUSP00000128277
Gene: ENSMUSG00000026070
AA Change: Y356*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000193391
AA Change: Y356*
SMART Domains Protein: ENSMUSP00000141695
Gene: ENSMUSG00000026070
AA Change: Y356*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193793
SMART Domains Protein: ENSMUSP00000141464
Gene: ENSMUSG00000026070

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 3.7e-3 SMART
IG_like 132 189 9.7e-3 SMART
Pfam:Ig_2 214 263 5.2e-1 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000195684
AA Change: Y356*
SMART Domains Protein: ENSMUSP00000142070
Gene: ENSMUSG00000026070
AA Change: Y356*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit impaire Th1 cell development and defective NK cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 A G 2: 164,804,735 V28A possibly damaging Het
Ak1 T A 2: 32,630,373 M61K probably damaging Het
Akap12 T C 10: 4,355,148 S653P probably damaging Het
Anapc4 G A 5: 52,864,553 R659H possibly damaging Het
Arel1 T C 12: 84,940,385 N86D possibly damaging Het
BC005561 A T 5: 104,522,303 I1564L probably benign Het
Bco1 A G 8: 117,127,506 D390G possibly damaging Het
Ccr1l1 A T 9: 123,978,166 D81E probably damaging Het
Chd1 A T 17: 15,730,602 N185I probably benign Het
Clca4b T G 3: 144,911,327 N854T possibly damaging Het
Col4a4 T C 1: 82,455,825 T1466A unknown Het
Cxcr4 T C 1: 128,589,094 I277V probably benign Het
Dgkq A G 5: 108,654,376 V441A possibly damaging Het
Dnah10 G T 5: 124,809,269 L3030F probably damaging Het
Epg5 T A 18: 77,948,254 D55E probably benign Het
Ermap A T 4: 119,178,140 N550K probably damaging Het
Fnbp1l A T 3: 122,556,440 I374N probably damaging Het
Gadl1 T A 9: 116,041,002 *479K probably null Het
Gm5591 T A 7: 38,519,035 T805S probably damaging Het
H2-T3 A T 17: 36,187,019 M334K possibly damaging Het
Ihh C T 1: 74,946,442 A295T probably damaging Het
Lingo3 A G 10: 80,835,316 V260A probably damaging Het
Lrp2 T G 2: 69,505,156 M1408L probably benign Het
Mical1 C A 10: 41,484,735 H657N probably benign Het
Mpp2 T A 11: 102,080,769 M12L probably benign Het
Muc16 A T 9: 18,641,721 D4425E probably benign Het
Muc4 T A 16: 32,759,320 probably null Het
Myt1l T A 12: 29,895,299 F1021Y unknown Het
Nbas T C 12: 13,288,749 S197P probably damaging Het
Nckap1 T C 2: 80,512,549 probably null Het
Nek1 T G 8: 61,100,012 V903G probably benign Het
Olfr1184 T A 2: 88,487,218 I162N possibly damaging Het
Olfr299 A G 7: 86,465,680 I90V probably damaging Het
Olfr377-ps1 T G 11: 73,388,691 S112R probably damaging Het
Olfr889 T C 9: 38,116,054 V91A possibly damaging Het
Ppm1j T C 3: 104,781,244 V53A probably benign Het
Ralgapb T A 2: 158,444,620 D328E probably damaging Het
Rgma T A 7: 73,409,694 V88E probably damaging Het
Slc30a6 A G 17: 74,423,113 T333A probably damaging Het
Spr T C 6: 85,137,057 probably null Het
Srek1 A T 13: 103,743,568 V494E probably benign Het
Ston1 A T 17: 88,635,303 T46S probably benign Het
Stox2 T C 8: 47,192,044 K858E possibly damaging Het
Thoc1 G A 18: 9,993,333 R564Q probably benign Het
Tmc5 T A 7: 118,645,316 N472K probably damaging Het
Ttc41 A G 10: 86,758,270 T856A possibly damaging Het
Ttn A T 2: 76,778,510 W17721R probably damaging Het
Vmn1r69 A G 7: 10,580,438 I43T probably benign Het
Vmn2r56 T A 7: 12,694,057 I761F probably damaging Het
Zfp109 T C 7: 24,228,445 D521G probably benign Het
Zfp516 A G 18: 82,987,350 H793R probably benign Het
Zfp800 A T 6: 28,244,216 I250N probably damaging Het
Zpbp T A 11: 11,408,538 Y243F probably damaging Het
Other mutations in Il18r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Il18r1 APN 1 40498652 missense possibly damaging 0.68
IGL00742:Il18r1 APN 1 40480991 missense probably benign 0.11
IGL01448:Il18r1 APN 1 40474730 missense probably damaging 1.00
IGL01726:Il18r1 APN 1 40498403 missense possibly damaging 0.83
IGL02081:Il18r1 APN 1 40498505 missense probably damaging 1.00
IGL02425:Il18r1 APN 1 40491221 splice site probably benign
IGL02447:Il18r1 APN 1 40498337 critical splice acceptor site probably null
IGL02529:Il18r1 APN 1 40487059 missense possibly damaging 0.77
IGL02863:Il18r1 APN 1 40487007 missense probably damaging 1.00
IGL02928:Il18r1 APN 1 40478551 critical splice donor site probably null
IGL02941:Il18r1 APN 1 40498551 missense probably damaging 0.99
IGL03156:Il18r1 APN 1 40498368 missense possibly damaging 0.92
R0532:Il18r1 UTSW 1 40474901 missense probably damaging 0.97
R0926:Il18r1 UTSW 1 40487028 missense probably damaging 1.00
R1909:Il18r1 UTSW 1 40474914 missense probably damaging 1.00
R2212:Il18r1 UTSW 1 40491067 missense probably damaging 1.00
R2254:Il18r1 UTSW 1 40491220 missense possibly damaging 0.91
R2860:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R2861:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R2862:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R3412:Il18r1 UTSW 1 40491067 missense probably damaging 1.00
R3432:Il18r1 UTSW 1 40487089 missense probably damaging 0.99
R3718:Il18r1 UTSW 1 40495788 missense probably benign 0.00
R3816:Il18r1 UTSW 1 40486972 splice site probably benign
R3894:Il18r1 UTSW 1 40474874 missense possibly damaging 0.79
R4061:Il18r1 UTSW 1 40474936 missense probably benign 0.33
R4062:Il18r1 UTSW 1 40474936 missense probably benign 0.33
R4381:Il18r1 UTSW 1 40471790 missense probably benign 0.00
R4972:Il18r1 UTSW 1 40491064 missense probably benign 0.39
R5059:Il18r1 UTSW 1 40481067 critical splice donor site probably null
R6229:Il18r1 UTSW 1 40474763 missense probably benign 0.02
R6505:Il18r1 UTSW 1 40489707 missense probably benign
R6738:Il18r1 UTSW 1 40498656 missense probably benign 0.06
R7002:Il18r1 UTSW 1 40474853 missense probably benign 0.39
R7317:Il18r1 UTSW 1 40474832 missense possibly damaging 0.80
X0023:Il18r1 UTSW 1 40471761 missense probably benign 0.04
X0064:Il18r1 UTSW 1 40495713 intron probably null
Z1088:Il18r1 UTSW 1 40474751 missense probably damaging 1.00
Z1088:Il18r1 UTSW 1 40478486 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGCCACATGCCTTTGATC -3'
(R):5'- CGCCTGTTTCAGTGTAACCC -3'

Sequencing Primer
(F):5'- AGCCACATGCCTTTGATCCTTTG -3'
(R):5'- AGAGTAACCCCTGACTCCAG -3'
Posted On2018-05-21