Incidental Mutation 'R6458:Ermap'
ID517422
Institutional Source Beutler Lab
Gene Symbol Ermap
Ensembl Gene ENSMUSG00000028644
Gene Nameerythroblast membrane-associated protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6458 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location119175457-119190011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119178140 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 550 (N550K)
Ref Sequence ENSEMBL: ENSMUSP00000123426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030396] [ENSMUST00000052715] [ENSMUST00000106355] [ENSMUST00000138395] [ENSMUST00000154226] [ENSMUST00000179290]
Predicted Effect probably benign
Transcript: ENSMUST00000030396
SMART Domains Protein: ENSMUSP00000030396
Gene: ENSMUSG00000028644

DomainStartEndE-ValueType
IGv 68 151 9.26e-8 SMART
Blast:IG_like 174 260 1e-19 BLAST
transmembrane domain 272 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052715
SMART Domains Protein: ENSMUSP00000053013
Gene: ENSMUSG00000045268

DomainStartEndE-ValueType
ZnF_C2H2 83 105 4.54e-4 SMART
ZnF_C2H2 111 133 5.99e-4 SMART
ZnF_C2H2 139 161 3.89e-3 SMART
ZnF_C2H2 167 189 3.95e-4 SMART
ZnF_C2H2 195 217 4.72e-2 SMART
ZnF_C2H2 223 245 2.4e-3 SMART
ZnF_C2H2 251 273 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106355
SMART Domains Protein: ENSMUSP00000101962
Gene: ENSMUSG00000045268

DomainStartEndE-ValueType
ZnF_C2H2 83 105 4.54e-4 SMART
ZnF_C2H2 111 133 5.99e-4 SMART
ZnF_C2H2 139 161 3.89e-3 SMART
ZnF_C2H2 167 189 3.95e-4 SMART
ZnF_C2H2 195 217 4.72e-2 SMART
ZnF_C2H2 223 245 2.4e-3 SMART
ZnF_C2H2 251 273 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137080
Predicted Effect probably damaging
Transcript: ENSMUST00000138395
AA Change: N550K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123426
Gene: ENSMUSG00000028644
AA Change: N550K

DomainStartEndE-ValueType
IGv 68 151 9.26e-8 SMART
transmembrane domain 272 294 N/A INTRINSIC
coiled coil region 304 342 N/A INTRINSIC
PRY 354 406 1.15e-27 SMART
SPRY 407 532 3.25e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154226
Predicted Effect probably benign
Transcript: ENSMUST00000179290
SMART Domains Protein: ENSMUSP00000136119
Gene: ENSMUSG00000045268

DomainStartEndE-ValueType
ZnF_C2H2 83 105 4.54e-4 SMART
ZnF_C2H2 111 133 5.99e-4 SMART
ZnF_C2H2 139 161 3.89e-3 SMART
ZnF_C2H2 167 189 3.95e-4 SMART
ZnF_C2H2 195 217 4.72e-2 SMART
ZnF_C2H2 223 245 2.4e-3 SMART
ZnF_C2H2 251 273 1.6e-4 SMART
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell surface transmembrane protein that may act as an erythroid cell receptor, possibly as a mediator of cell adhesion. Polymorphisms in this gene are responsible for the Scianna/Radin blood group system. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 A G 2: 164,804,735 V28A possibly damaging Het
Ak1 T A 2: 32,630,373 M61K probably damaging Het
Akap12 T C 10: 4,355,148 S653P probably damaging Het
Anapc4 G A 5: 52,864,553 R659H possibly damaging Het
Arel1 T C 12: 84,940,385 N86D possibly damaging Het
BC005561 A T 5: 104,522,303 I1564L probably benign Het
Bco1 A G 8: 117,127,506 D390G possibly damaging Het
Ccr1l1 A T 9: 123,978,166 D81E probably damaging Het
Chd1 A T 17: 15,730,602 N185I probably benign Het
Clca4b T G 3: 144,911,327 N854T possibly damaging Het
Col4a4 T C 1: 82,455,825 T1466A unknown Het
Cxcr4 T C 1: 128,589,094 I277V probably benign Het
Dgkq A G 5: 108,654,376 V441A possibly damaging Het
Dnah10 G T 5: 124,809,269 L3030F probably damaging Het
Epg5 T A 18: 77,948,254 D55E probably benign Het
Fnbp1l A T 3: 122,556,440 I374N probably damaging Het
Gadl1 T A 9: 116,041,002 *479K probably null Het
Gm5591 T A 7: 38,519,035 T805S probably damaging Het
H2-T3 A T 17: 36,187,019 M334K possibly damaging Het
Ihh C T 1: 74,946,442 A295T probably damaging Het
Il18r1 T A 1: 40,491,182 Y356* probably null Het
Lingo3 A G 10: 80,835,316 V260A probably damaging Het
Lrp2 T G 2: 69,505,156 M1408L probably benign Het
Mical1 C A 10: 41,484,735 H657N probably benign Het
Mpp2 T A 11: 102,080,769 M12L probably benign Het
Muc16 A T 9: 18,641,721 D4425E probably benign Het
Muc4 T A 16: 32,759,320 probably null Het
Myt1l T A 12: 29,895,299 F1021Y unknown Het
Nbas T C 12: 13,288,749 S197P probably damaging Het
Nckap1 T C 2: 80,512,549 probably null Het
Nek1 T G 8: 61,100,012 V903G probably benign Het
Olfr1184 T A 2: 88,487,218 I162N possibly damaging Het
Olfr299 A G 7: 86,465,680 I90V probably damaging Het
Olfr377-ps1 T G 11: 73,388,691 S112R probably damaging Het
Olfr889 T C 9: 38,116,054 V91A possibly damaging Het
Ppm1j T C 3: 104,781,244 V53A probably benign Het
Ralgapb T A 2: 158,444,620 D328E probably damaging Het
Rgma T A 7: 73,409,694 V88E probably damaging Het
Slc30a6 A G 17: 74,423,113 T333A probably damaging Het
Spr T C 6: 85,137,057 probably null Het
Srek1 A T 13: 103,743,568 V494E probably benign Het
Ston1 A T 17: 88,635,303 T46S probably benign Het
Stox2 T C 8: 47,192,044 K858E possibly damaging Het
Thoc1 G A 18: 9,993,333 R564Q probably benign Het
Tmc5 T A 7: 118,645,316 N472K probably damaging Het
Ttc41 A G 10: 86,758,270 T856A possibly damaging Het
Ttn A T 2: 76,778,510 W17721R probably damaging Het
Vmn1r69 A G 7: 10,580,438 I43T probably benign Het
Vmn2r56 T A 7: 12,694,057 I761F probably damaging Het
Zfp109 T C 7: 24,228,445 D521G probably benign Het
Zfp516 A G 18: 82,987,350 H793R probably benign Het
Zfp800 A T 6: 28,244,216 I250N probably damaging Het
Zpbp T A 11: 11,408,538 Y243F probably damaging Het
Other mutations in Ermap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ermap APN 4 119183917 missense probably damaging 1.00
IGL01402:Ermap APN 4 119187158 missense probably damaging 1.00
IGL02471:Ermap APN 4 119179963 missense probably damaging 0.99
IGL02696:Ermap APN 4 119187707 missense possibly damaging 0.89
IGL02806:Ermap APN 4 119188916 missense possibly damaging 0.91
R0017:Ermap UTSW 4 119179948 splice site probably benign
R0645:Ermap UTSW 4 119185691 missense probably benign 0.04
R0737:Ermap UTSW 4 119178510 missense probably damaging 1.00
R1204:Ermap UTSW 4 119188867 missense possibly damaging 0.91
R1239:Ermap UTSW 4 119188925 missense probably benign
R1351:Ermap UTSW 4 119181361 splice site probably null
R1597:Ermap UTSW 4 119183955 missense probably damaging 1.00
R4128:Ermap UTSW 4 119187111 missense possibly damaging 0.89
R4588:Ermap UTSW 4 119188248 intron probably benign
R4853:Ermap UTSW 4 119187254 missense probably damaging 1.00
R4906:Ermap UTSW 4 119188818 intron probably benign
R4946:Ermap UTSW 4 119183308 missense probably damaging 1.00
R5187:Ermap UTSW 4 119185818 critical splice acceptor site probably null
R6275:Ermap UTSW 4 119178550 missense probably damaging 1.00
R6301:Ermap UTSW 4 119185603 missense probably damaging 1.00
R6896:Ermap UTSW 4 119187131 nonsense probably null
R6997:Ermap UTSW 4 119178613 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGCAGAGTTCAGAACCG -3'
(R):5'- ATGAAGCCGGCATCATCTCC -3'

Sequencing Primer
(F):5'- AGAGTTCAGAACCGAGCCCTG -3'
(R):5'- TTCTACAACGTGACTGATAAGTCCC -3'
Posted On2018-05-21