Incidental Mutation 'R6458:Dgkq'
ID517425
Institutional Source Beutler Lab
Gene Symbol Dgkq
Ensembl Gene ENSMUSG00000004815
Gene Namediacylglycerol kinase, theta
Synonyms110kDa, DAGK7, Dagk4, Dgkd, Dgk theta
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R6458 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location108646693-108669672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108654376 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 441 (V441A)
Ref Sequence ENSEMBL: ENSMUSP00000057859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053913] [ENSMUST00000132179] [ENSMUST00000132708] [ENSMUST00000153238]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053913
AA Change: V441A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057859
Gene: ENSMUSG00000004815
AA Change: V441A

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
C1 114 162 1.73e-2 SMART
C1 178 228 1.58e-13 SMART
low complexity region 267 275 N/A INTRINSIC
RA 387 486 2.08e-20 SMART
DAGKc 580 707 4.79e-63 SMART
DAGKa 733 885 7e-88 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123669
Predicted Effect probably benign
Transcript: ENSMUST00000132179
SMART Domains Protein: ENSMUSP00000118466
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
Blast:C1 114 144 1e-12 BLAST
low complexity region 156 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132708
SMART Domains Protein: ENSMUSP00000122837
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
Blast:C1 26 56 2e-13 BLAST
low complexity region 68 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145917
Predicted Effect probably benign
Transcript: ENSMUST00000153238
SMART Domains Protein: ENSMUSP00000118065
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
Blast:C1 114 144 1e-12 BLAST
low complexity region 156 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156964
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains three cysteine-rich domains, a proline-rich region, and a pleckstrin homology domain with an overlapping Ras-associating domain. It is localized in the speckle domains of the nucleus, and mediates the regeneration of phosphatidylinositol (PI) from diacylglycerol in the PI-cycle during cell signal transduction. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 A G 2: 164,804,735 V28A possibly damaging Het
Ak1 T A 2: 32,630,373 M61K probably damaging Het
Akap12 T C 10: 4,355,148 S653P probably damaging Het
Anapc4 G A 5: 52,864,553 R659H possibly damaging Het
Arel1 T C 12: 84,940,385 N86D possibly damaging Het
BC005561 A T 5: 104,522,303 I1564L probably benign Het
Bco1 A G 8: 117,127,506 D390G possibly damaging Het
Ccr1l1 A T 9: 123,978,166 D81E probably damaging Het
Chd1 A T 17: 15,730,602 N185I probably benign Het
Clca4b T G 3: 144,911,327 N854T possibly damaging Het
Col4a4 T C 1: 82,455,825 T1466A unknown Het
Cxcr4 T C 1: 128,589,094 I277V probably benign Het
Dnah10 G T 5: 124,809,269 L3030F probably damaging Het
Epg5 T A 18: 77,948,254 D55E probably benign Het
Ermap A T 4: 119,178,140 N550K probably damaging Het
Fnbp1l A T 3: 122,556,440 I374N probably damaging Het
Gadl1 T A 9: 116,041,002 *479K probably null Het
Gm5591 T A 7: 38,519,035 T805S probably damaging Het
H2-T3 A T 17: 36,187,019 M334K possibly damaging Het
Ihh C T 1: 74,946,442 A295T probably damaging Het
Il18r1 T A 1: 40,491,182 Y356* probably null Het
Lingo3 A G 10: 80,835,316 V260A probably damaging Het
Lrp2 T G 2: 69,505,156 M1408L probably benign Het
Mical1 C A 10: 41,484,735 H657N probably benign Het
Mpp2 T A 11: 102,080,769 M12L probably benign Het
Muc16 A T 9: 18,641,721 D4425E probably benign Het
Muc4 T A 16: 32,759,320 probably null Het
Myt1l T A 12: 29,895,299 F1021Y unknown Het
Nbas T C 12: 13,288,749 S197P probably damaging Het
Nckap1 T C 2: 80,512,549 probably null Het
Nek1 T G 8: 61,100,012 V903G probably benign Het
Olfr1184 T A 2: 88,487,218 I162N possibly damaging Het
Olfr299 A G 7: 86,465,680 I90V probably damaging Het
Olfr377-ps1 T G 11: 73,388,691 S112R probably damaging Het
Olfr889 T C 9: 38,116,054 V91A possibly damaging Het
Ppm1j T C 3: 104,781,244 V53A probably benign Het
Ralgapb T A 2: 158,444,620 D328E probably damaging Het
Rgma T A 7: 73,409,694 V88E probably damaging Het
Slc30a6 A G 17: 74,423,113 T333A probably damaging Het
Spr T C 6: 85,137,057 probably null Het
Srek1 A T 13: 103,743,568 V494E probably benign Het
Ston1 A T 17: 88,635,303 T46S probably benign Het
Stox2 T C 8: 47,192,044 K858E possibly damaging Het
Thoc1 G A 18: 9,993,333 R564Q probably benign Het
Tmc5 T A 7: 118,645,316 N472K probably damaging Het
Ttc41 A G 10: 86,758,270 T856A possibly damaging Het
Ttn A T 2: 76,778,510 W17721R probably damaging Het
Vmn1r69 A G 7: 10,580,438 I43T probably benign Het
Vmn2r56 T A 7: 12,694,057 I761F probably damaging Het
Zfp109 T C 7: 24,228,445 D521G probably benign Het
Zfp516 A G 18: 82,987,350 H793R probably benign Het
Zfp800 A T 6: 28,244,216 I250N probably damaging Het
Zpbp T A 11: 11,408,538 Y243F probably damaging Het
Other mutations in Dgkq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Dgkq APN 5 108654582 missense possibly damaging 0.72
IGL02364:Dgkq APN 5 108656444 missense probably benign 0.05
IGL02966:Dgkq APN 5 108656421 splice site probably null
IGL03297:Dgkq APN 5 108650274 missense probably damaging 1.00
R0179:Dgkq UTSW 5 108658200 splice site probably benign
R0194:Dgkq UTSW 5 108654644 intron probably benign
R0332:Dgkq UTSW 5 108655099 splice site probably benign
R0513:Dgkq UTSW 5 108656495 missense probably benign 0.02
R0525:Dgkq UTSW 5 108654615 missense probably damaging 1.00
R0673:Dgkq UTSW 5 108655589 missense probably damaging 0.97
R0801:Dgkq UTSW 5 108660720 utr 5 prime probably null
R0850:Dgkq UTSW 5 108654578 missense possibly damaging 0.82
R0944:Dgkq UTSW 5 108656465 missense probably damaging 1.00
R1069:Dgkq UTSW 5 108656037 splice site probably benign
R1411:Dgkq UTSW 5 108650362 missense probably damaging 1.00
R1488:Dgkq UTSW 5 108650877 missense probably damaging 1.00
R1858:Dgkq UTSW 5 108653731 missense probably benign 0.00
R1874:Dgkq UTSW 5 108660595 missense probably benign 0.07
R2210:Dgkq UTSW 5 108660523 missense probably damaging 1.00
R4499:Dgkq UTSW 5 108649661 missense possibly damaging 0.54
R5061:Dgkq UTSW 5 108654123 missense probably benign 0.02
R5474:Dgkq UTSW 5 108649143 critical splice donor site probably null
R5481:Dgkq UTSW 5 108648810 unclassified probably null
R5951:Dgkq UTSW 5 108654370 missense probably damaging 1.00
R6193:Dgkq UTSW 5 108655500 nonsense probably null
R6429:Dgkq UTSW 5 108653708 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATCGTCCCTTCCACAAATAG -3'
(R):5'- GTGGTTCAAGAGGTTCTCCC -3'

Sequencing Primer
(F):5'- CAAATAGTTGCTCTAAGTCTCTGGG -3'
(R):5'- CAAGAGGTTCTCCCACTGTTTGG -3'
Posted On2018-05-21