Incidental Mutation 'R6458:Ston1'
ID517459
Institutional Source Beutler Lab
Gene Symbol Ston1
Ensembl Gene ENSMUSG00000033855
Gene Namestonin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R6458 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location88597684-88662586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88635303 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 46 (T46S)
Ref Sequence ENSEMBL: ENSMUSP00000118522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064035] [ENSMUST00000137138] [ENSMUST00000150023] [ENSMUST00000163588]
Predicted Effect probably benign
Transcript: ENSMUST00000064035
AA Change: T46S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000067027
Gene: ENSMUSG00000033855
AA Change: T46S

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 707 5.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132384
Predicted Effect probably benign
Transcript: ENSMUST00000137138
AA Change: T46S

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118522
Gene: ENSMUSG00000033855
AA Change: T46S

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150023
AA Change: T46S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122928
Gene: ENSMUSG00000033855
AA Change: T46S

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 707 5.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153613
Predicted Effect probably benign
Transcript: ENSMUST00000163588
AA Change: T46S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131703
Gene: ENSMUSG00000033855
AA Change: T46S

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 711 2.1e-64 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Endocytosis of cell surface proteins is mediated by a complex molecular machinery that assembles on the inner surface of the plasma membrane. This gene encodes one of two human homologs of the Drosophila melanogaster stoned B protein. This protein is related to components of the endocytic machinery and exhibits a modular structure consisting of an N-terminal proline-rich domain, a central region of homology specific to the human stoned B-like proteins, and a C-terminal region homologous to the mu subunits of adaptor protein (AP) complexes. Read-through transcription of this gene into the neighboring downstream gene, which encodes TFIIA-alpha/beta-like factor, generates a transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal. Mouse embryonic fibroblasts derived from homozygous null mice display alterations in focal adhesion dynamics and an increase in cellular signaling and directional cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 A G 2: 164,804,735 V28A possibly damaging Het
Ak1 T A 2: 32,630,373 M61K probably damaging Het
Akap12 T C 10: 4,355,148 S653P probably damaging Het
Anapc4 G A 5: 52,864,553 R659H possibly damaging Het
Arel1 T C 12: 84,940,385 N86D possibly damaging Het
BC005561 A T 5: 104,522,303 I1564L probably benign Het
Bco1 A G 8: 117,127,506 D390G possibly damaging Het
Ccr1l1 A T 9: 123,978,166 D81E probably damaging Het
Chd1 A T 17: 15,730,602 N185I probably benign Het
Clca4b T G 3: 144,911,327 N854T possibly damaging Het
Col4a4 T C 1: 82,455,825 T1466A unknown Het
Cxcr4 T C 1: 128,589,094 I277V probably benign Het
Dgkq A G 5: 108,654,376 V441A possibly damaging Het
Dnah10 G T 5: 124,809,269 L3030F probably damaging Het
Epg5 T A 18: 77,948,254 D55E probably benign Het
Ermap A T 4: 119,178,140 N550K probably damaging Het
Fnbp1l A T 3: 122,556,440 I374N probably damaging Het
Gadl1 T A 9: 116,041,002 *479K probably null Het
Gm5591 T A 7: 38,519,035 T805S probably damaging Het
H2-T3 A T 17: 36,187,019 M334K possibly damaging Het
Ihh C T 1: 74,946,442 A295T probably damaging Het
Il18r1 T A 1: 40,491,182 Y356* probably null Het
Lingo3 A G 10: 80,835,316 V260A probably damaging Het
Lrp2 T G 2: 69,505,156 M1408L probably benign Het
Mical1 C A 10: 41,484,735 H657N probably benign Het
Mpp2 T A 11: 102,080,769 M12L probably benign Het
Muc16 A T 9: 18,641,721 D4425E probably benign Het
Muc4 T A 16: 32,759,320 probably null Het
Myt1l T A 12: 29,895,299 F1021Y unknown Het
Nbas T C 12: 13,288,749 S197P probably damaging Het
Nckap1 T C 2: 80,512,549 probably null Het
Nek1 T G 8: 61,100,012 V903G probably benign Het
Olfr1184 T A 2: 88,487,218 I162N possibly damaging Het
Olfr299 A G 7: 86,465,680 I90V probably damaging Het
Olfr377-ps1 T G 11: 73,388,691 S112R probably damaging Het
Olfr889 T C 9: 38,116,054 V91A possibly damaging Het
Ppm1j T C 3: 104,781,244 V53A probably benign Het
Ralgapb T A 2: 158,444,620 D328E probably damaging Het
Rgma T A 7: 73,409,694 V88E probably damaging Het
Slc30a6 A G 17: 74,423,113 T333A probably damaging Het
Spr T C 6: 85,137,057 probably null Het
Srek1 A T 13: 103,743,568 V494E probably benign Het
Stox2 T C 8: 47,192,044 K858E possibly damaging Het
Thoc1 G A 18: 9,993,333 R564Q probably benign Het
Tmc5 T A 7: 118,645,316 N472K probably damaging Het
Ttc41 A G 10: 86,758,270 T856A possibly damaging Het
Ttn A T 2: 76,778,510 W17721R probably damaging Het
Vmn1r69 A G 7: 10,580,438 I43T probably benign Het
Vmn2r56 T A 7: 12,694,057 I761F probably damaging Het
Zfp109 T C 7: 24,228,445 D521G probably benign Het
Zfp516 A G 18: 82,987,350 H793R probably benign Het
Zfp800 A T 6: 28,244,216 I250N probably damaging Het
Zpbp T A 11: 11,408,538 Y243F probably damaging Het
Other mutations in Ston1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Ston1 APN 17 88644443 missense probably benign 0.00
IGL01593:Ston1 APN 17 88637010 missense probably null 1.00
FR4449:Ston1 UTSW 17 88635525 missense probably benign 0.38
R0610:Ston1 UTSW 17 88635281 missense possibly damaging 0.49
R1421:Ston1 UTSW 17 88635793 missense probably benign 0.02
R1620:Ston1 UTSW 17 88635816 missense probably benign 0.01
R2002:Ston1 UTSW 17 88635529 missense probably benign 0.01
R3108:Ston1 UTSW 17 88636155 nonsense probably null
R3766:Ston1 UTSW 17 88635360 missense probably damaging 1.00
R4222:Ston1 UTSW 17 88636771 missense probably damaging 1.00
R4335:Ston1 UTSW 17 88635697 missense probably damaging 1.00
R4355:Ston1 UTSW 17 88637008 missense probably damaging 1.00
R4867:Ston1 UTSW 17 88635694 missense probably damaging 1.00
R4902:Ston1 UTSW 17 88645252 missense probably damaging 0.99
R5084:Ston1 UTSW 17 88636574 missense probably benign 0.00
R5434:Ston1 UTSW 17 88645311 utr 3 prime probably benign
R5700:Ston1 UTSW 17 88644339 missense probably damaging 1.00
R5858:Ston1 UTSW 17 88635631 missense possibly damaging 0.93
R5863:Ston1 UTSW 17 88635945 missense possibly damaging 0.64
R6459:Ston1 UTSW 17 88636468 missense probably benign 0.16
R7012:Ston1 UTSW 17 88635985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTCTCCTTTACAGAGACAACGAC -3'
(R):5'- GCACTGCTTGAAGAACACTC -3'

Sequencing Primer
(F):5'- GAGACAACGACCCTGACTATTTG -3'
(R):5'- CTGCTTGAAGAACACTCTGGAATAG -3'
Posted On2018-05-21