Incidental Mutation 'R6487:Oog2'
ID517473
Institutional Source Beutler Lab
Gene Symbol Oog2
Ensembl Gene ENSMUSG00000066030
Gene Nameoogenesin 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6487 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location144190719-144196934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144196485 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 440 (E440G)
Ref Sequence ENSEMBL: ENSMUSP00000079267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080405] [ENSMUST00000143978]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080405
AA Change: E440G

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079267
Gene: ENSMUSG00000066030
AA Change: E440G

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 391 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141847
Predicted Effect probably benign
Transcript: ENSMUST00000143978
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,397,472 Y963H possibly damaging Het
Alpk2 T C 18: 65,266,183 N2108S possibly damaging Het
Atp13a1 T C 8: 69,799,878 S641P probably damaging Het
BC048403 T C 10: 121,745,541 L13P probably damaging Het
Bptf C T 11: 107,077,726 V981I probably damaging Het
Cntrl A T 2: 35,122,682 K277N possibly damaging Het
Cops5 T C 1: 10,037,779 T12A probably benign Het
Cyp2c37 A T 19: 39,994,581 T205S probably benign Het
Dnah7c T C 1: 46,769,124 V3485A probably damaging Het
Ifna6 A T 4: 88,827,506 N31Y probably damaging Het
Irgm1 C A 11: 48,865,950 A345S probably benign Het
Med13 T C 11: 86,331,150 T218A probably damaging Het
Mroh2b G T 15: 4,947,239 D1225Y probably damaging Het
Npepl1 A G 2: 174,111,732 E152G probably benign Het
Olfr1170 A G 2: 88,224,526 S169P possibly damaging Het
Olfr1260 A T 2: 89,977,838 D20V probably benign Het
Olfr1282 T C 2: 111,335,667 D137G probably benign Het
Olfr196 A T 16: 59,168,173 probably null Het
Olfr921 A G 9: 38,775,435 Y60C probably damaging Het
Ranbp2 T C 10: 58,485,741 V2620A probably benign Het
Rims4 A T 2: 163,864,897 F187Y possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Shisa9 C T 16: 12,244,611 T232I probably benign Het
Slf1 A T 13: 77,066,617 I650N probably damaging Het
Tpst2 T C 5: 112,308,123 L176P probably damaging Het
U2surp A T 9: 95,477,512 M650K probably damaging Het
Vmn1r17 A T 6: 57,361,224 M3K possibly damaging Het
Vmn1r55 A G 7: 5,146,555 S290P probably benign Het
Vmn2r102 G A 17: 19,677,907 E395K probably damaging Het
Wapl T A 14: 34,692,292 H370Q probably damaging Het
Xab2 T C 8: 3,613,879 S347G possibly damaging Het
Other mutations in Oog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Oog2 APN 4 144195172 missense probably damaging 1.00
IGL01317:Oog2 APN 4 144195267 missense probably benign 0.16
IGL01697:Oog2 APN 4 144195184 missense possibly damaging 0.90
IGL02237:Oog2 APN 4 144196446 missense possibly damaging 0.95
IGL02411:Oog2 APN 4 144195048 missense probably damaging 0.99
IGL02476:Oog2 APN 4 144195229 missense probably benign 0.02
IGL03284:Oog2 APN 4 144196607 unclassified probably benign
IGL03394:Oog2 APN 4 144194006 missense probably benign 0.17
R0538:Oog2 UTSW 4 144196084 nonsense probably null
R0892:Oog2 UTSW 4 144196499 missense probably benign 0.00
R1024:Oog2 UTSW 4 144196286 missense probably damaging 1.00
R4156:Oog2 UTSW 4 144193953 intron probably benign
R4157:Oog2 UTSW 4 144193953 intron probably benign
R4166:Oog2 UTSW 4 144194841 missense probably damaging 1.00
R4167:Oog2 UTSW 4 144196212 missense probably benign 0.18
R4732:Oog2 UTSW 4 144193941 intron probably benign
R4734:Oog2 UTSW 4 144196451 missense probably benign 0.00
R4741:Oog2 UTSW 4 144195145 missense possibly damaging 0.94
R4909:Oog2 UTSW 4 144195099 missense possibly damaging 0.78
R4954:Oog2 UTSW 4 144190732 start gained probably benign
R6437:Oog2 UTSW 4 144195108 unclassified probably null
R6946:Oog2 UTSW 4 144196464 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCCTAAGTCAATGTTACCAGCTC -3'
(R):5'- CCAGCAAGGGACATTCACTTAG -3'

Sequencing Primer
(F):5'- GTCAATGTTACCAGCTCACAGTAG -3'
(R):5'- GCAAGGGACATTCACTTAGGATATC -3'
Posted On2018-05-21