Incidental Mutation 'R6459:Pak1'
ID517516
Institutional Source Beutler Lab
Gene Symbol Pak1
Ensembl Gene ENSMUSG00000030774
Gene Namep21 (RAC1) activated kinase 1
SynonymsPaka, PAK-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6459 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location97788541-97912381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97907881 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 495 (D495G)
Ref Sequence ENSEMBL: ENSMUSP00000146055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033040] [ENSMUST00000156637] [ENSMUST00000206984]
Predicted Effect probably benign
Transcript: ENSMUST00000033040
AA Change: D495G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000033040
Gene: ENSMUSG00000030774
AA Change: D495G

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
PBD 75 110 3.92e-16 SMART
low complexity region 168 191 N/A INTRINSIC
S_TKc 269 520 7.19e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156637
SMART Domains Protein: ENSMUSP00000138684
Gene: ENSMUSG00000030774

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
PBD 75 110 3.92e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206984
AA Change: D495G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207017
Meta Mutation Damage Score 0.396 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a family member of serine/threonine p21-activating kinases, known as PAK proteins. These proteins are critical effectors that link RhoGTPases to cytoskeleton reorganization and nuclear signaling, and they serve as targets for the small GTP binding proteins Cdc42 and Rac. This specific family member regulates cell motility and morphology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display defects in allergen-induced mast cell migration and degranulation. Mice homozygous for a different knock-out allele exhibit reduced long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr C A 11: 76,424,989 R583L probably damaging Het
Acss1 A G 2: 150,667,920 I93T probably damaging Het
Ank3 C T 10: 69,991,747 probably benign Het
Aoah A G 13: 20,999,942 Y392C probably damaging Het
Atl3 A T 19: 7,520,798 E186D probably benign Het
Atp4a A G 7: 30,712,462 K41E probably benign Het
Atp9a G A 2: 168,668,013 P500L probably damaging Het
Ccdc88b A T 19: 6,854,878 V363D possibly damaging Het
Cftr T C 6: 18,258,236 V532A probably damaging Het
Cldn13 T C 5: 134,914,915 T139A possibly damaging Het
Cnksr3 T C 10: 7,126,820 Y124C probably benign Het
Cyb5r2 T C 7: 107,753,255 K161E possibly damaging Het
Epop T C 11: 97,628,507 S259G possibly damaging Het
Fhl2 G A 1: 43,123,653 T234I possibly damaging Het
Fnip2 T C 3: 79,481,634 T567A possibly damaging Het
Frmd4b A G 6: 97,487,640 C39R probably damaging Het
Grhl3 T C 4: 135,557,433 N116S possibly damaging Het
Igkv14-111 A T 6: 68,256,741 R75S probably benign Het
Il16 A T 7: 83,722,321 D92E probably damaging Het
Il16 C A 7: 83,722,328 G90V probably damaging Het
Ipo11 T C 13: 106,865,769 probably null Het
Kng2 A G 16: 23,012,115 I148T probably damaging Het
Lrrc41 T C 4: 116,088,780 S231P possibly damaging Het
Maneal C T 4: 124,856,842 V374I possibly damaging Het
Mgat4c T A 10: 102,385,127 L90Q probably damaging Het
Mrps28 A G 3: 8,899,980 probably null Het
Ncapd3 A G 9: 27,051,755 D452G probably benign Het
Nefh T C 11: 4,939,551 T1023A unknown Het
Nipa1 A G 7: 55,979,606 V253A probably benign Het
Olfr1028 G T 2: 85,951,518 G152C probably damaging Het
Olfr1447 G T 19: 12,901,005 F258L possibly damaging Het
Olfr199 C T 16: 59,216,020 V198M probably benign Het
Olfr228 T A 2: 86,483,229 H171L probably benign Het
Olfr930 A G 9: 38,930,665 S165G probably benign Het
Pcm1 G A 8: 41,261,036 R213H probably damaging Het
Prg4 T C 1: 150,454,301 probably benign Het
Proser1 C T 3: 53,478,329 T544M possibly damaging Het
Rftn1 T C 17: 50,047,306 M343V probably benign Het
Ryr1 T C 7: 29,015,654 I4656V probably benign Het
Scg2 T A 1: 79,436,290 N239Y probably damaging Het
Sec16a C A 2: 26,423,500 M1949I probably benign Het
Sipa1l2 A G 8: 125,444,484 probably null Het
Slc10a2 A C 8: 5,098,581 probably null Het
Slc25a16 C T 10: 62,937,477 Q164* probably null Het
Specc1l T C 10: 75,246,167 Y483H probably damaging Het
Ston1 T C 17: 88,636,468 V434A probably benign Het
Tarbp2 A G 15: 102,518,479 probably benign Het
Trappc8 C T 18: 20,836,868 V1022M probably benign Het
Tsen54 T C 11: 115,821,680 V269A probably damaging Het
Vps13a A T 19: 16,664,018 M78K possibly damaging Het
Vwa5b2 A G 16: 20,594,679 T215A probably damaging Het
Zc3h7a A G 16: 11,153,161 Y335H probably damaging Het
Zfp994 T A 17: 22,200,546 Q474L possibly damaging Het
Other mutations in Pak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Pak1 APN 7 97854568 missense probably benign 0.03
IGL01676:Pak1 APN 7 97883531 missense probably benign 0.00
IGL02058:Pak1 APN 7 97911115 missense probably damaging 1.00
IGL02557:Pak1 APN 7 97871587 missense probably benign 0.08
IGL02678:Pak1 APN 7 97894002 missense probably damaging 0.99
R1739:Pak1 UTSW 7 97904695 missense probably damaging 1.00
R1874:Pak1 UTSW 7 97871580 missense probably benign 0.23
R2057:Pak1 UTSW 7 97907797 splice site probably null
R2363:Pak1 UTSW 7 97886314 missense probably benign 0.01
R2420:Pak1 UTSW 7 97854479 missense probably benign 0.02
R2880:Pak1 UTSW 7 97904811 missense probably damaging 1.00
R3113:Pak1 UTSW 7 97866114 nonsense probably null
R3722:Pak1 UTSW 7 97854497 missense probably damaging 1.00
R4363:Pak1 UTSW 7 97883586 missense possibly damaging 0.49
R6021:Pak1 UTSW 7 97854463 missense probably damaging 1.00
R6820:Pak1 UTSW 7 97886379 missense probably benign
R7336:Pak1 UTSW 7 97888972 missense probably benign 0.13
X0027:Pak1 UTSW 7 97904752 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTTAGTATGTTCTCTTCAGGACAT -3'
(R):5'- CCCAAGAGTGACAGGGAGCT -3'

Sequencing Primer
(F):5'- GACATCCCCGCTGATCAGAG -3'
(R):5'- TGACAGGGAGCTAGAAATACAAAGTG -3'
Posted On2018-05-21