Mutagenetix > Incidental Mutation

Incidental Mutation 'R6461:Smarca4'

517605

Institutional Source

Beutler Lab

Gene Symbol

Smarca4

Ensembl Gene

ENSMUSG00000032187

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4

Synonyms

SW1/SNF, Brg1, SNF2beta, b2b692Clo, b2b508.1Clo

MMRRC Submission

044390-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6461 (G1)

Quality Score

224.009

Status

Not validated

Chromosome

Chromosomal Location

21527465-21615526 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 21590316 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1152 (I1152N)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034707] [ENSMUST00000098948] [ENSMUST00000174008]

AlphaFold

Q3TKT4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034707
AA Change: I1315N

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000034707
Gene: ENSMUSG00000032187
AA Change: I1315N

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1360	1385	N/A	INTRINSIC
low complexity region	1388	1398	N/A	INTRINSIC
BROMO	1422	1533	4.19e-42	SMART
low complexity region	1534	1557	N/A	INTRINSIC
low complexity region	1578	1588	N/A	INTRINSIC
low complexity region	1594	1614	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098948
AA Change: I1315N

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000096547
Gene: ENSMUSG00000032187
AA Change: I1315N

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1363	1388	N/A	INTRINSIC
low complexity region	1391	1401	N/A	INTRINSIC
BROMO	1425	1536	4.19e-42	SMART
low complexity region	1537	1560	N/A	INTRINSIC
low complexity region	1581	1591	N/A	INTRINSIC
low complexity region	1597	1617	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172996
AA Change: I1152N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133535
Gene: ENSMUSG00000032187
AA Change: I1152N

Domain	Start	End	E-Value	Type
low complexity region	26	52	N/A	INTRINSIC
low complexity region	57	94	N/A	INTRINSIC
low complexity region	109	135	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
HSA	265	337	2e-27	SMART
coiled coil region	367	399	N/A	INTRINSIC
BRK	417	461	5.17e-21	SMART
low complexity region	462	477	N/A	INTRINSIC
low complexity region	496	507	N/A	INTRINSIC
DEXDc	555	747	5.17e-38	SMART
Blast:DEXDc	758	790	6e-10	BLAST
low complexity region	824	839	N/A	INTRINSIC
HELICc	915	999	7.27e-24	SMART
low complexity region	1088	1105	N/A	INTRINSIC
SnAC	1126	1194	2.8e-29	SMART
low complexity region	1201	1226	N/A	INTRINSIC
low complexity region	1229	1239	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174008
AA Change: I1315N

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000133922
Gene: ENSMUSG00000032187
AA Change: I1315N

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1360	1385	N/A	INTRINSIC
low complexity region	1388	1398	N/A	INTRINSIC
BROMO	1422	1532	1.36e-41	SMART
low complexity region	1533	1556	N/A	INTRINSIC
low complexity region	1577	1587	N/A	INTRINSIC
low complexity region	1593	1613	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184017

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a null allele die in utero before implantation. Embryos heterozygous for this null allele and an ENU-induced allele show impaired definitive erythropoiesis, anemia and lethality during organogenesis. Heterozygotes for a different null allele show cyanosis and cardiovascular defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb3	T	A	10: 85,476,428 (GRCm39)	I903N	probably damaging	Het
Atp12a	C	T	14: 56,610,695 (GRCm39)	R280C	probably damaging	Het
Dnmbp	A	G	19: 43,855,964 (GRCm39)		probably null	Het
Enpp5	G	A	17: 44,396,155 (GRCm39)	G356S	probably damaging	Het
Fbxo40	T	C	16: 36,790,390 (GRCm39)	E240G	probably benign	Het
Gne	T	C	4: 44,060,078 (GRCm39)	D105G	probably damaging	Het
Grin2c	A	T	11: 115,146,522 (GRCm39)	M494K	possibly damaging	Het
Hnrnpk	A	G	13: 58,541,008 (GRCm39)		probably null	Het
Irf6	G	C	1: 192,849,779 (GRCm39)	G234R	probably damaging	Het
Lman2	A	G	13: 55,494,728 (GRCm39)	F347L	probably damaging	Het
Mcfd2	G	A	17: 87,565,494 (GRCm39)	T3I	probably benign	Het
Mon1b	A	G	8: 114,365,170 (GRCm39)	D166G	probably damaging	Het
Mup10	T	A	4: 60,538,078 (GRCm39)	M4L	unknown	Het
Or13c7b	T	C	4: 43,821,355 (GRCm39)	E2G	probably benign	Het
Or2h1b	C	T	17: 37,462,362 (GRCm39)	C167Y	probably damaging	Het
Or51s1	T	A	7: 102,558,235 (GRCm39)	R270S	possibly damaging	Het
Papln	A	G	12: 83,828,587 (GRCm39)		probably null	Het
Pelp1	A	T	11: 70,287,132 (GRCm39)	V522E	probably damaging	Het
Scn1a	T	C	2: 66,156,466 (GRCm39)	D481G	probably null	Het
Scube1	G	A	15: 83,496,628 (GRCm39)	T791I	probably damaging	Het
Sec24a	T	C	11: 51,604,373 (GRCm39)	I748V	possibly damaging	Het
Slc29a2	A	G	19: 5,077,768 (GRCm39)	T236A	probably benign	Het
Syngap1	A	G	17: 27,183,822 (GRCm39)	I1026V	probably damaging	Het
Tnxb	G	T	17: 34,890,872 (GRCm39)	R405L	probably damaging	Het
Zbtb11	G	A	16: 55,827,234 (GRCm39)	R900H	probably damaging	Het
Zfp142	T	C	1: 74,606,344 (GRCm39)	K1639R	probably damaging	Het

Other mutations in Smarca4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Smarca4	APN	9	21,590,369 (GRCm39)	missense	probably benign	0.30
IGL01694:Smarca4	APN	9	21,577,166 (GRCm39)	missense	probably damaging	1.00
IGL02147:Smarca4	APN	9	21,546,999 (GRCm39)	missense	probably damaging	0.98
IGL02417:Smarca4	APN	9	21,612,386 (GRCm39)	missense	probably damaging	1.00
IGL02421:Smarca4	APN	9	21,550,535 (GRCm39)	missense	probably damaging	1.00
IGL02550:Smarca4	APN	9	21,597,418 (GRCm39)	missense	probably benign	0.25
IGL02794:Smarca4	APN	9	21,584,638 (GRCm39)	splice site	probably benign
IGL03030:Smarca4	APN	9	21,547,132 (GRCm39)	missense	probably benign	0.14
IGL03037:Smarca4	APN	9	21,544,231 (GRCm39)	unclassified	probably benign
IGL03069:Smarca4	APN	9	21,547,132 (GRCm39)	missense	probably benign	0.14
IGL03355:Smarca4	APN	9	21,547,132 (GRCm39)	missense	probably benign	0.14
R0123:Smarca4	UTSW	9	21,548,620 (GRCm39)	missense	probably damaging	1.00
R0134:Smarca4	UTSW	9	21,548,620 (GRCm39)	missense	probably damaging	1.00
R0230:Smarca4	UTSW	9	21,612,168 (GRCm39)	missense	probably damaging	0.99
R0269:Smarca4	UTSW	9	21,547,497 (GRCm39)	missense	probably benign	0.09
R0631:Smarca4	UTSW	9	21,570,280 (GRCm39)	splice site	probably benign
R0665:Smarca4	UTSW	9	21,612,239 (GRCm39)	small deletion	probably benign
R0726:Smarca4	UTSW	9	21,611,435 (GRCm39)	critical splice donor site	probably null
R0801:Smarca4	UTSW	9	21,553,850 (GRCm39)	missense	possibly damaging	0.81
R0918:Smarca4	UTSW	9	21,547,511 (GRCm39)	missense	probably benign	0.16
R1411:Smarca4	UTSW	9	21,570,251 (GRCm39)	missense	probably damaging	1.00
R1604:Smarca4	UTSW	9	21,612,239 (GRCm39)	small deletion	probably benign
R1768:Smarca4	UTSW	9	21,612,479 (GRCm39)	missense	possibly damaging	0.56
R2004:Smarca4	UTSW	9	21,588,776 (GRCm39)	missense	probably damaging	1.00
R2031:Smarca4	UTSW	9	21,597,358 (GRCm39)	missense	possibly damaging	0.68
R2211:Smarca4	UTSW	9	21,597,325 (GRCm39)	missense	probably damaging	1.00
R2512:Smarca4	UTSW	9	21,546,994 (GRCm39)	missense	possibly damaging	0.95
R2875:Smarca4	UTSW	9	21,553,876 (GRCm39)	missense	possibly damaging	0.55
R3786:Smarca4	UTSW	9	21,583,355 (GRCm39)	missense	possibly damaging	0.94
R4829:Smarca4	UTSW	9	21,550,623 (GRCm39)	missense	probably damaging	0.97
R5084:Smarca4	UTSW	9	21,572,059 (GRCm39)	missense	probably damaging	1.00
R5222:Smarca4	UTSW	9	21,567,002 (GRCm39)	missense	probably benign	0.01
R5785:Smarca4	UTSW	9	21,597,322 (GRCm39)	missense	probably damaging	0.99
R5844:Smarca4	UTSW	9	21,589,238 (GRCm39)	intron	probably benign
R5964:Smarca4	UTSW	9	21,558,726 (GRCm39)	missense	probably benign	0.00
R6001:Smarca4	UTSW	9	21,544,205 (GRCm39)	unclassified	probably benign
R6072:Smarca4	UTSW	9	21,611,417 (GRCm39)	missense	probably damaging	1.00
R6254:Smarca4	UTSW	9	21,611,173 (GRCm39)	missense	probably damaging	1.00
R6320:Smarca4	UTSW	9	21,548,671 (GRCm39)	missense	probably damaging	1.00
R6353:Smarca4	UTSW	9	21,590,445 (GRCm39)	critical splice donor site	probably null
R6886:Smarca4	UTSW	9	21,570,127 (GRCm39)	missense	probably damaging	1.00
R7098:Smarca4	UTSW	9	21,546,116 (GRCm39)	missense	probably benign	0.10
R7253:Smarca4	UTSW	9	21,570,256 (GRCm39)	missense	probably benign	0.01
R7307:Smarca4	UTSW	9	21,550,096 (GRCm39)	missense	probably damaging	1.00
R7382:Smarca4	UTSW	9	21,570,229 (GRCm39)	missense	probably damaging	0.98
R7445:Smarca4	UTSW	9	21,597,543 (GRCm39)	missense	probably damaging	1.00
R7535:Smarca4	UTSW	9	21,558,921 (GRCm39)	missense	possibly damaging	0.82
R7573:Smarca4	UTSW	9	21,550,371 (GRCm39)	splice site	probably null
R7644:Smarca4	UTSW	9	21,566,950 (GRCm39)	missense	probably benign	0.00
R7734:Smarca4	UTSW	9	21,578,658 (GRCm39)	missense	possibly damaging	0.65
R7833:Smarca4	UTSW	9	21,558,655 (GRCm39)	missense	possibly damaging	0.86
R8085:Smarca4	UTSW	9	21,570,108 (GRCm39)	splice site	probably null
R8119:Smarca4	UTSW	9	21,558,922 (GRCm39)	missense	possibly damaging	0.61
R8320:Smarca4	UTSW	9	21,588,798 (GRCm39)	missense	probably benign	0.10
R8445:Smarca4	UTSW	9	21,612,239 (GRCm39)	small deletion	probably benign
R8493:Smarca4	UTSW	9	21,570,144 (GRCm39)	missense	probably damaging	1.00
R8748:Smarca4	UTSW	9	21,546,164 (GRCm39)	missense	possibly damaging	0.85
R8788:Smarca4	UTSW	9	21,550,024 (GRCm39)	missense	probably damaging	1.00
R8817:Smarca4	UTSW	9	21,547,497 (GRCm39)	missense	probably benign	0.04
R9241:Smarca4	UTSW	9	21,550,604 (GRCm39)	missense	possibly damaging	0.72
R9446:Smarca4	UTSW	9	21,547,155 (GRCm39)	missense	unknown
R9570:Smarca4	UTSW	9	21,580,849 (GRCm39)	missense	probably damaging	1.00
R9727:Smarca4	UTSW	9	21,611,160 (GRCm39)	missense	probably damaging	1.00
R9801:Smarca4	UTSW	9	21,586,397 (GRCm39)	missense	probably damaging	1.00
Z1176:Smarca4	UTSW	9	21,614,253 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCACCTAGTGTCCCTGTGAG -3'
(R):5'- GGAAGGTATCAGTTTGGATGACC -3'

Sequencing Primer
(F):5'- GAGGCCCATTCTGAAGGCTATTTC -3'
(R):5'- CAAGAAGGTCAGCCTCTGC -3'

Posted On

2018-05-21