Incidental Mutation 'R6463:Dnm1'
ID517664
Institutional Source Beutler Lab
Gene Symbol Dnm1
Ensembl Gene ENSMUSG00000026825
Gene Namedynamin 1
Synonymsdynamin 1, Ftfl
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6463 (G1)
Quality Score156.008
Status Validated
Chromosome2
Chromosomal Location32308471-32353338 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 32309591 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078352] [ENSMUST00000081670] [ENSMUST00000091089] [ENSMUST00000100194] [ENSMUST00000113350] [ENSMUST00000113352] [ENSMUST00000113365] [ENSMUST00000113377] [ENSMUST00000129156] [ENSMUST00000139624] [ENSMUST00000201433] [ENSMUST00000201440] [ENSMUST00000201494] [ENSMUST00000202578]
Predicted Effect probably benign
Transcript: ENSMUST00000078352
SMART Domains Protein: ENSMUSP00000077461
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081670
SMART Domains Protein: ENSMUSP00000080374
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
coiled coil region 105 173 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Pfam:GOLGA2L5 337 955 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000091089
AA Change: T857A
SMART Domains Protein: ENSMUSP00000088618
Gene: ENSMUSG00000026825
AA Change: T857A

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 516 623 2.7e-10 SMART
GED 650 741 9.51e-32 SMART
low complexity region 743 757 N/A INTRINSIC
low complexity region 779 812 N/A INTRINSIC
low complexity region 815 826 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100194
SMART Domains Protein: ENSMUSP00000097768
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
coiled coil region 176 244 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 372 384 N/A INTRINSIC
Pfam:GOLGA2L5 408 1026 2.1e-299 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113350
SMART Domains Protein: ENSMUSP00000108977
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113352
SMART Domains Protein: ENSMUSP00000108979
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113365
SMART Domains Protein: ENSMUSP00000108992
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113377
SMART Domains Protein: ENSMUSP00000109004
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
coiled coil region 149 217 N/A INTRINSIC
low complexity region 233 246 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:GOLGA2L5 381 999 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126276
Predicted Effect probably benign
Transcript: ENSMUST00000129156
SMART Domains Protein: ENSMUSP00000118914
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
PH 1 96 2.75e-2 SMART
GED 123 214 9.51e-32 SMART
low complexity region 216 230 N/A INTRINSIC
low complexity region 239 258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139291
SMART Domains Protein: ENSMUSP00000115523
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
Pfam:GED 1 43 3.3e-7 PFAM
low complexity region 45 59 N/A INTRINSIC
low complexity region 81 114 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139624
SMART Domains Protein: ENSMUSP00000122679
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145885
Predicted Effect probably benign
Transcript: ENSMUST00000155269
SMART Domains Protein: ENSMUSP00000116054
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
GED 1 53 1.63e-1 SMART
low complexity region 55 69 N/A INTRINSIC
low complexity region 91 124 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156866
Predicted Effect probably benign
Transcript: ENSMUST00000201433
SMART Domains Protein: ENSMUSP00000144264
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201440
SMART Domains Protein: ENSMUSP00000144309
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
Pfam:GED 1 41 5.9e-7 PFAM
low complexity region 43 57 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201494
SMART Domains Protein: ENSMUSP00000144145
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 6.9e-180 SMART
Pfam:Dynamin_M 413 473 2.1e-14 PFAM
PH 491 598 1.2e-12 SMART
GED 625 716 6.1e-34 SMART
low complexity region 718 732 N/A INTRINSIC
low complexity region 754 787 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 822 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202578
SMART Domains Protein: ENSMUSP00000143955
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a member of the dynamin subfamily of GTP-binding proteins. The encoded protein is a GTPase which is required for membrane recycling, including vesicle endocytosis in neurons. It may also be involved in cellular fission via association with microtubules and actin filaments. Mutations in this gene have been shown to cause seizures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mice display reduced postnatal viability. Null mutation of this gene results in abnormal synaptic vesicle morphology, and recycling during neuronal activity. Other alleles are associated with seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Cep63 C A 9: 102,596,155 M504I probably benign Het
Chpf2 G T 5: 24,589,526 L231F probably damaging Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Fbp1 A G 13: 62,865,010 F123S possibly damaging Het
Hkdc1 T C 10: 62,393,702 N732S probably damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Oas2 T C 5: 120,734,981 R670G probably null Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Olfr698 C G 7: 106,752,801 E196Q probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
Slc6a20b T A 9: 123,604,949 I275F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trh A T 6: 92,242,843 M164K possibly damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Ttll7 G A 3: 146,931,582 R490Q possibly damaging Het
Uck1 T C 2: 32,258,655 N100S probably benign Het
Ucp3 A T 7: 100,480,269 T104S probably benign Het
Vmn2r28 T A 7: 5,486,436 H468L probably benign Het
Xaf1 G A 11: 72,308,638 R67H probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Zfp687 A G 3: 95,010,784 I559T probably damaging Het
Other mutations in Dnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02219:Dnm1 APN 2 32323450 missense probably benign 0.18
IGL02338:Dnm1 APN 2 32312771 missense probably damaging 1.00
IGL02555:Dnm1 APN 2 32328038 missense probably damaging 1.00
IGL02563:Dnm1 APN 2 32315919 splice site probably null
IGL03006:Dnm1 APN 2 32353121 missense possibly damaging 0.84
IGL03013:Dnm1 APN 2 32336284 missense probably benign 0.13
IGL03347:Dnm1 APN 2 32353187 missense probably benign 0.32
R0180:Dnm1 UTSW 2 32327993 missense probably damaging 0.99
R0242:Dnm1 UTSW 2 32316989 missense possibly damaging 0.55
R0242:Dnm1 UTSW 2 32316989 missense possibly damaging 0.55
R0387:Dnm1 UTSW 2 32320581 missense possibly damaging 0.90
R0608:Dnm1 UTSW 2 32335824 missense possibly damaging 0.89
R1230:Dnm1 UTSW 2 32315909 missense probably damaging 1.00
R1474:Dnm1 UTSW 2 32320584 missense probably benign 0.31
R1703:Dnm1 UTSW 2 32323451 missense probably benign 0.01
R1881:Dnm1 UTSW 2 32323730 missense probably damaging 1.00
R2155:Dnm1 UTSW 2 32314937 missense probably damaging 0.96
R4405:Dnm1 UTSW 2 32335972 missense probably damaging 1.00
R4592:Dnm1 UTSW 2 32336011 missense probably damaging 0.99
R5357:Dnm1 UTSW 2 32336241 missense probably null 0.17
R5926:Dnm1 UTSW 2 32315804 missense probably benign 0.00
R6135:Dnm1 UTSW 2 32333063 splice site probably null
R6563:Dnm1 UTSW 2 32312726 missense probably damaging 1.00
R6626:Dnm1 UTSW 2 32340880 missense probably damaging 1.00
R6707:Dnm1 UTSW 2 32336241 missense probably null 0.17
R6790:Dnm1 UTSW 2 32333067 missense probably damaging 1.00
R6803:Dnm1 UTSW 2 32312754 missense probably damaging 1.00
R7156:Dnm1 UTSW 2 32340467 missense probably damaging 1.00
R7313:Dnm1 UTSW 2 32336009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTCCCATGTAACAGCCATGAG -3'
(R):5'- GTTTTCAGAGTGACCTGTGCC -3'

Sequencing Primer
(F):5'- CCATGAGGCCAGAAGTGCTTG -3'
(R):5'- GACCTGTGCCTTTTAGCCGAAG -3'
Posted On2018-05-21