Incidental Mutation 'R6463:Zfp687'
ID517670
Institutional Source Beutler Lab
Gene Symbol Zfp687
Ensembl Gene ENSMUSG00000019338
Gene Namezinc finger protein 687
Synonyms4931408L03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #R6463 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95006590-95015448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95010784 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 559 (I559T)
Ref Sequence ENSEMBL: ENSMUSP00000123335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019482] [ENSMUST00000072287] [ENSMUST00000107251] [ENSMUST00000125476] [ENSMUST00000128438] [ENSMUST00000132195] [ENSMUST00000133297] [ENSMUST00000137799] [ENSMUST00000149747] [ENSMUST00000167008]
Predicted Effect probably damaging
Transcript: ENSMUST00000019482
AA Change: I559T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019482
Gene: ENSMUSG00000019338
AA Change: I559T

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
ZnF_C2H2 533 553 4.74e1 SMART
ZnF_C2H2 561 585 1.43e1 SMART
low complexity region 615 634 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
ZnF_C2H2 673 693 7.37e1 SMART
ZnF_C2H2 705 727 1.99e0 SMART
ZnF_C2H2 733 757 3.38e1 SMART
ZnF_C2H2 764 787 2.67e-1 SMART
ZnF_C2H2 792 815 4.4e-2 SMART
ZnF_C2H2 827 849 7.67e-2 SMART
ZnF_C2H2 858 881 2.36e-2 SMART
low complexity region 884 898 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
ZnF_C2H2 964 987 4.05e-1 SMART
ZnF_C2H2 994 1017 1.38e-3 SMART
ZnF_C2H2 1024 1050 4.65e-1 SMART
low complexity region 1057 1075 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
ZnF_C2H2 1135 1158 4.98e-1 SMART
ZnF_C2H2 1200 1222 1.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072287
SMART Domains Protein: ENSMUSP00000072134
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 545 799 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107251
SMART Domains Protein: ENSMUSP00000102872
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 560 814 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125476
SMART Domains Protein: ENSMUSP00000121965
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
SCOP:d1e8xa1 152 243 5e-22 SMART
PI3Kc 572 826 6.47e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128160
Predicted Effect probably benign
Transcript: ENSMUST00000128438
SMART Domains Protein: ENSMUSP00000119354
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132195
SMART Domains Protein: ENSMUSP00000117308
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133166
Predicted Effect probably benign
Transcript: ENSMUST00000133297
SMART Domains Protein: ENSMUSP00000123529
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
PI3Kc 1 225 7.13e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137799
AA Change: I559T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123335
Gene: ENSMUSG00000019338
AA Change: I559T

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
ZnF_C2H2 533 553 4.74e1 SMART
ZnF_C2H2 561 585 1.43e1 SMART
low complexity region 615 634 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
ZnF_C2H2 673 693 7.37e1 SMART
ZnF_C2H2 705 727 1.99e0 SMART
ZnF_C2H2 733 757 3.38e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147022
Predicted Effect probably benign
Transcript: ENSMUST00000149747
SMART Domains Protein: ENSMUSP00000116053
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167008
SMART Domains Protein: ENSMUSP00000132150
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
PI3Kc 228 482 6.47e-105 SMART
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes C2H2 zinc finger protein. The encoded protein may play a role in bone differentiation and development. Mutations in this gene are the cause of Paget disease of bone-6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Cep63 C A 9: 102,596,155 M504I probably benign Het
Chpf2 G T 5: 24,589,526 L231F probably damaging Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Dnm1 T C 2: 32,309,591 probably benign Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Fbp1 A G 13: 62,865,010 F123S possibly damaging Het
Hkdc1 T C 10: 62,393,702 N732S probably damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Oas2 T C 5: 120,734,981 R670G probably null Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Olfr698 C G 7: 106,752,801 E196Q probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
Slc6a20b T A 9: 123,604,949 I275F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trh A T 6: 92,242,843 M164K possibly damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Ttll7 G A 3: 146,931,582 R490Q possibly damaging Het
Uck1 T C 2: 32,258,655 N100S probably benign Het
Ucp3 A T 7: 100,480,269 T104S probably benign Het
Vmn2r28 T A 7: 5,486,436 H468L probably benign Het
Xaf1 G A 11: 72,308,638 R67H probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Other mutations in Zfp687
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp687 APN 3 95012416 missense probably damaging 1.00
IGL00510:Zfp687 APN 3 95008447 missense probably damaging 1.00
IGL00824:Zfp687 APN 3 95009185 missense probably damaging 1.00
IGL01861:Zfp687 APN 3 95011860 missense probably damaging 1.00
IGL02167:Zfp687 APN 3 95010530 missense probably benign
IGL02169:Zfp687 APN 3 95011432 missense probably damaging 1.00
IGL02260:Zfp687 APN 3 95011264 missense possibly damaging 0.92
IGL02539:Zfp687 APN 3 95011062 missense probably damaging 0.99
IGL02710:Zfp687 APN 3 95008773 missense probably benign 0.01
IGL02891:Zfp687 APN 3 95011946 missense probably damaging 0.97
IGL03186:Zfp687 APN 3 95011094 missense probably benign
R0006:Zfp687 UTSW 3 95011456 missense probably damaging 0.99
R0006:Zfp687 UTSW 3 95011456 missense probably damaging 0.99
R0243:Zfp687 UTSW 3 95011553 missense probably damaging 0.99
R0556:Zfp687 UTSW 3 95010408 missense probably damaging 1.00
R1111:Zfp687 UTSW 3 95009512 missense probably damaging 1.00
R1170:Zfp687 UTSW 3 95008473 missense probably damaging 1.00
R1236:Zfp687 UTSW 3 95012044 missense probably benign 0.01
R1482:Zfp687 UTSW 3 95007533 missense probably damaging 1.00
R1711:Zfp687 UTSW 3 95011889 missense probably benign 0.00
R2255:Zfp687 UTSW 3 95010437 missense probably damaging 1.00
R3763:Zfp687 UTSW 3 95012080 missense probably damaging 1.00
R3848:Zfp687 UTSW 3 95007914 missense probably damaging 1.00
R3850:Zfp687 UTSW 3 95007914 missense probably damaging 1.00
R4424:Zfp687 UTSW 3 95009128 missense probably damaging 1.00
R4630:Zfp687 UTSW 3 95012488 splice site probably null
R4989:Zfp687 UTSW 3 95010386 missense probably damaging 1.00
R5119:Zfp687 UTSW 3 95011676 missense probably benign 0.28
R5134:Zfp687 UTSW 3 95010386 missense probably damaging 1.00
R5249:Zfp687 UTSW 3 95009466 missense probably damaging 1.00
R5408:Zfp687 UTSW 3 95009275 unclassified probably benign
R5454:Zfp687 UTSW 3 95009146 missense probably damaging 1.00
R5732:Zfp687 UTSW 3 95011217 missense possibly damaging 0.50
R5883:Zfp687 UTSW 3 95012044 missense probably benign 0.01
R6342:Zfp687 UTSW 3 95011877 missense probably benign 0.01
R6395:Zfp687 UTSW 3 95007738 missense possibly damaging 0.48
R6575:Zfp687 UTSW 3 95008389 missense probably damaging 1.00
R6972:Zfp687 UTSW 3 95009377 missense possibly damaging 0.65
R6973:Zfp687 UTSW 3 95009377 missense possibly damaging 0.65
R7087:Zfp687 UTSW 3 95010213 missense probably benign 0.08
R7407:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7408:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7483:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7492:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7514:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAAGGGTGTGATGTCTG -3'
(R):5'- CCTTCCAAGTCTGCTACTGG -3'

Sequencing Primer
(F):5'- TGATGTCTGGCTGCCCCAC -3'
(R):5'- TCTGGTAGAGGCCTTCAACAAGATC -3'
Posted On2018-05-21