Incidental Mutation 'R6463:Ttll7'
ID517672
Institutional Source Beutler Lab
Gene Symbol Ttll7
Ensembl Gene ENSMUSG00000036745
Gene Nametubulin tyrosine ligase-like family, member 7
Synonyms1110049N09Rik, 4921517B04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R6463 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location146852367-146984009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 146931582 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 490 (R490Q)
Ref Sequence ENSEMBL: ENSMUSP00000043753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037942] [ENSMUST00000106134] [ENSMUST00000170055]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037942
AA Change: R490Q

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000038090
SMART Domains Protein: ENSMUSP00000037875
Gene: ENSMUSG00000036745

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 9e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106134
AA Change: R490Q

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101740
Gene: ENSMUSG00000036745
AA Change: R490Q

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 7.2e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170055
AA Change: R490Q

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129369
Gene: ENSMUSG00000036745
AA Change: R490Q

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 5.9e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Cep63 C A 9: 102,596,155 M504I probably benign Het
Chpf2 G T 5: 24,589,526 L231F probably damaging Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Dnm1 T C 2: 32,309,591 probably benign Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Fbp1 A G 13: 62,865,010 F123S possibly damaging Het
Hkdc1 T C 10: 62,393,702 N732S probably damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Oas2 T C 5: 120,734,981 R670G probably null Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Olfr698 C G 7: 106,752,801 E196Q probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
Slc6a20b T A 9: 123,604,949 I275F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trh A T 6: 92,242,843 M164K possibly damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Uck1 T C 2: 32,258,655 N100S probably benign Het
Ucp3 A T 7: 100,480,269 T104S probably benign Het
Vmn2r28 T A 7: 5,486,436 H468L probably benign Het
Xaf1 G A 11: 72,308,638 R67H probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Zfp687 A G 3: 95,010,784 I559T probably damaging Het
Other mutations in Ttll7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ttll7 APN 3 146909582 missense possibly damaging 0.72
IGL01353:Ttll7 APN 3 146961719 missense probably damaging 1.00
IGL01415:Ttll7 APN 3 146909599 missense possibly damaging 0.90
IGL01843:Ttll7 APN 3 146940021 missense possibly damaging 0.93
IGL03101:Ttll7 APN 3 146896690 missense possibly damaging 0.82
IGL03378:Ttll7 APN 3 146909653 missense probably benign 0.06
P0038:Ttll7 UTSW 3 146945184 missense possibly damaging 0.80
R0265:Ttll7 UTSW 3 146944160 nonsense probably null
R0358:Ttll7 UTSW 3 146944116 missense probably benign
R0363:Ttll7 UTSW 3 146944215 missense probably benign 0.00
R0364:Ttll7 UTSW 3 146945181 missense possibly damaging 0.82
R0751:Ttll7 UTSW 3 146939991 missense probably damaging 1.00
R1184:Ttll7 UTSW 3 146939991 missense probably damaging 1.00
R1533:Ttll7 UTSW 3 146896667 missense probably damaging 1.00
R1771:Ttll7 UTSW 3 146894405 missense probably benign 0.02
R1789:Ttll7 UTSW 3 146915780 missense probably damaging 1.00
R1961:Ttll7 UTSW 3 146915795 splice site probably benign
R1995:Ttll7 UTSW 3 146961755 missense possibly damaging 0.95
R2083:Ttll7 UTSW 3 146930104 missense possibly damaging 0.77
R2152:Ttll7 UTSW 3 146930189 missense probably damaging 1.00
R2655:Ttll7 UTSW 3 146947621 missense probably damaging 1.00
R2926:Ttll7 UTSW 3 146930415 nonsense probably null
R4888:Ttll7 UTSW 3 146894177 start codon destroyed probably null 0.99
R4999:Ttll7 UTSW 3 146894469 missense probably damaging 1.00
R5648:Ttll7 UTSW 3 146961710 missense probably damaging 1.00
R5937:Ttll7 UTSW 3 146944092 nonsense probably null
R6009:Ttll7 UTSW 3 146934535 missense probably damaging 0.99
R6036:Ttll7 UTSW 3 146940162 missense probably benign
R6036:Ttll7 UTSW 3 146940162 missense probably benign
R6747:Ttll7 UTSW 3 146944056 missense probably benign 0.02
R6922:Ttll7 UTSW 3 146909614 missense possibly damaging 0.92
R7123:Ttll7 UTSW 3 146913296 missense possibly damaging 0.95
R7211:Ttll7 UTSW 3 146913276 missense probably damaging 0.97
X0024:Ttll7 UTSW 3 146909553 missense probably damaging 1.00
X0026:Ttll7 UTSW 3 146961695 missense probably damaging 1.00
X0027:Ttll7 UTSW 3 146947653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTGATCTTAGCTCCTGG -3'
(R):5'- ATGTGTATATATCTGTGTGCATGC -3'

Sequencing Primer
(F):5'- GATTGCGTCAGATTCTTGTAAGCAC -3'
(R):5'- TTTGCCCCATAAAGCACTGGG -3'
Posted On2018-05-21