Incidental Mutation 'R6463:Oas2'
ID517679
Institutional Source Beutler Lab
Gene Symbol Oas2
Ensembl Gene ENSMUSG00000032690
Gene Name2'-5' oligoadenylate synthetase 2
Synonyms2'-5' oligoadenylate synthetase-like 11, Oasl11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6463 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location120730333-120749853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120734981 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 670 (R670G)
Ref Sequence ENSEMBL: ENSMUSP00000080209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053909] [ENSMUST00000081491]
Predicted Effect probably null
Transcript: ENSMUST00000053909
AA Change: R670G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060082
Gene: ENSMUSG00000032690
AA Change: R670G

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
Pfam:OAS1_C 190 378 5.6e-75 PFAM
Pfam:NTP_transf_2 412 516 4e-9 PFAM
Pfam:OAS1_C 533 724 3.2e-86 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000081491
AA Change: R670G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080209
Gene: ENSMUSG00000032690
AA Change: R670G

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
Pfam:OAS1_C 191 376 1.9e-77 PFAM
Pfam:NTP_transf_2 412 516 1.3e-10 PFAM
Pfam:OAS1_C 534 722 2.6e-87 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146101
AA Change: R180G
SMART Domains Protein: ENSMUSP00000122053
Gene: ENSMUSG00000032690
AA Change: R180G

DomainStartEndE-ValueType
Pfam:OAS1_C 45 233 2.8e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147941
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 2-5A synthetase family, essential proteins involved in the innate immune response to viral infection. The encoded protein is induced by interferons and uses adenosine triphosphate in 2'-specific nucleotidyl transfer reactions to synthesize 2',5'-oligoadenylates (2-5As). These molecules activate latent RNase L, which results in viral RNA degradation and the inhibition of viral replication. The three known members of this gene family are located in a cluster on chromosome 12. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: In nursing mothers, homozygous knockout (by a point mutation in a critical domain) results in a failure of the alveoli to expand and a failure to lactate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Cep63 C A 9: 102,596,155 M504I probably benign Het
Chpf2 G T 5: 24,589,526 L231F probably damaging Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Dnm1 T C 2: 32,309,591 probably benign Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Fbp1 A G 13: 62,865,010 F123S possibly damaging Het
Hkdc1 T C 10: 62,393,702 N732S probably damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Olfr698 C G 7: 106,752,801 E196Q probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
Slc6a20b T A 9: 123,604,949 I275F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trh A T 6: 92,242,843 M164K possibly damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Ttll7 G A 3: 146,931,582 R490Q possibly damaging Het
Uck1 T C 2: 32,258,655 N100S probably benign Het
Ucp3 A T 7: 100,480,269 T104S probably benign Het
Vmn2r28 T A 7: 5,486,436 H468L probably benign Het
Xaf1 G A 11: 72,308,638 R67H probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Zfp687 A G 3: 95,010,784 I559T probably damaging Het
Other mutations in Oas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Oas2 APN 5 120738363 missense probably damaging 1.00
IGL00784:Oas2 APN 5 120738363 missense probably damaging 1.00
IGL01388:Oas2 APN 5 120748592 missense probably damaging 1.00
IGL01643:Oas2 APN 5 120736187 splice site probably benign
IGL01660:Oas2 APN 5 120741223 missense probably benign 0.00
IGL02346:Oas2 APN 5 120736088 missense probably benign 0.30
IGL02403:Oas2 APN 5 120748750 missense possibly damaging 0.59
IGL03297:Oas2 APN 5 120735085 missense possibly damaging 0.91
R0149:Oas2 UTSW 5 120738401 missense probably damaging 0.99
R0344:Oas2 UTSW 5 120743087 missense probably damaging 1.00
R0361:Oas2 UTSW 5 120738401 missense probably damaging 0.99
R0387:Oas2 UTSW 5 120745672 splice site probably benign
R0465:Oas2 UTSW 5 120735055 missense probably damaging 0.99
R2100:Oas2 UTSW 5 120745675 critical splice donor site probably null
R2324:Oas2 UTSW 5 120743274 missense probably benign 0.43
R2496:Oas2 UTSW 5 120748617 missense probably benign 0.00
R4357:Oas2 UTSW 5 120738669 critical splice donor site probably null
R4466:Oas2 UTSW 5 120749602 missense probably damaging 0.99
R4472:Oas2 UTSW 5 120741155 missense possibly damaging 0.81
R4632:Oas2 UTSW 5 120733481 missense probably benign 0.34
R4714:Oas2 UTSW 5 120733472 missense probably damaging 1.00
R4824:Oas2 UTSW 5 120738346 missense probably benign 0.32
R4872:Oas2 UTSW 5 120738534 missense probably damaging 1.00
R5629:Oas2 UTSW 5 120738451 nonsense probably null
R6351:Oas2 UTSW 5 120748538 missense probably benign
R6488:Oas2 UTSW 5 120738363 missense probably damaging 1.00
R6787:Oas2 UTSW 5 120738798 missense possibly damaging 0.77
R6945:Oas2 UTSW 5 120736139 missense probably benign 0.00
R7353:Oas2 UTSW 5 120738522 missense probably damaging 1.00
R7459:Oas2 UTSW 5 120749710 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAATGCTCTCTGCCTGCTG -3'
(R):5'- CTCCCCACCAGTATGAAAGG -3'

Sequencing Primer
(F):5'- ATCCCTCCTGGTTGGCAAG -3'
(R):5'- AGCTGCTCACCGTGTATG -3'
Posted On2018-05-21