Incidental Mutation 'R6463:Slc6a20b'
ID517694
Institutional Source Beutler Lab
Gene Symbol Slc6a20b
Ensembl Gene ENSMUSG00000025243
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 20B
SynonymsSit1, XT3, Xtrp3, Slc6a20
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6463 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location123590800-123632565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123604949 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 275 (I275F)
Ref Sequence ENSEMBL: ENSMUSP00000150479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026273] [ENSMUST00000166800]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026273
AA Change: I275F

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026273
Gene: ENSMUSG00000025243
AA Change: I275F

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
Pfam:SNF 48 624 5.4e-173 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163397
SMART Domains Protein: ENSMUSP00000127422
Gene: ENSMUSG00000025243

DomainStartEndE-ValueType
Pfam:SNF 23 59 1.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164241
Predicted Effect possibly damaging
Transcript: ENSMUST00000166800
AA Change: I275F

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000168824
SMART Domains Protein: ENSMUSP00000129307
Gene: ENSMUSG00000025243

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:SNF 38 74 3.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171122
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Cep63 C A 9: 102,596,155 M504I probably benign Het
Chpf2 G T 5: 24,589,526 L231F probably damaging Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Dnm1 T C 2: 32,309,591 probably benign Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Fbp1 A G 13: 62,865,010 F123S possibly damaging Het
Hkdc1 T C 10: 62,393,702 N732S probably damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Oas2 T C 5: 120,734,981 R670G probably null Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Olfr698 C G 7: 106,752,801 E196Q probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trh A T 6: 92,242,843 M164K possibly damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Ttll7 G A 3: 146,931,582 R490Q possibly damaging Het
Uck1 T C 2: 32,258,655 N100S probably benign Het
Ucp3 A T 7: 100,480,269 T104S probably benign Het
Vmn2r28 T A 7: 5,486,436 H468L probably benign Het
Xaf1 G A 11: 72,308,638 R67H probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Zfp687 A G 3: 95,010,784 I559T probably damaging Het
Other mutations in Slc6a20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02430:Slc6a20b APN 9 123597240 missense probably damaging 1.00
IGL02741:Slc6a20b APN 9 123607602 missense probably damaging 1.00
IGL03038:Slc6a20b APN 9 123597329 missense possibly damaging 0.55
IGL03115:Slc6a20b APN 9 123597338 missense possibly damaging 0.82
IGL03228:Slc6a20b APN 9 123632132 nonsense probably null
PIT4131001:Slc6a20b UTSW 9 123612126 missense probably benign 0.00
R0653:Slc6a20b UTSW 9 123597312 missense probably damaging 1.00
R1072:Slc6a20b UTSW 9 123598459 missense probably damaging 0.97
R1759:Slc6a20b UTSW 9 123608997 critical splice donor site probably null
R1889:Slc6a20b UTSW 9 123632204 missense probably benign 0.02
R2075:Slc6a20b UTSW 9 123595034 missense probably benign 0.13
R2187:Slc6a20b UTSW 9 123598588 missense probably damaging 1.00
R4097:Slc6a20b UTSW 9 123612757 utr 3 prime probably benign
R4762:Slc6a20b UTSW 9 123598560 missense probably damaging 1.00
R4834:Slc6a20b UTSW 9 123596048 missense probably benign 0.00
R4932:Slc6a20b UTSW 9 123604796 missense probably damaging 1.00
R5079:Slc6a20b UTSW 9 123598498 missense probably damaging 1.00
R5095:Slc6a20b UTSW 9 123595054 missense probably benign
R5307:Slc6a20b UTSW 9 123603834 missense possibly damaging 0.62
R5721:Slc6a20b UTSW 9 123611989 missense probably null 1.00
R6108:Slc6a20b UTSW 9 123596186 missense probably benign 0.01
R6285:Slc6a20b UTSW 9 123609096 missense possibly damaging 0.81
R7050:Slc6a20b UTSW 9 123598543 missense probably damaging 1.00
R7411:Slc6a20b UTSW 9 123604948 missense probably benign 0.32
R7422:Slc6a20b UTSW 9 123607617 missense possibly damaging 0.95
R7460:Slc6a20b UTSW 9 123604949 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTGAAGGTGGCCTTGAAG -3'
(R):5'- TCAGAGACTACTTTACCGGGC -3'

Sequencing Primer
(F):5'- GGTGACAATACTGGAAAATATGGC -3'
(R):5'- CAGAGACTACTTTACCGGGCATTTAG -3'
Posted On2018-05-21