Incidental Mutation 'R6463:Xaf1'
ID517698
Institutional Source Beutler Lab
Gene Symbol Xaf1
Ensembl Gene ENSMUSG00000040483
Gene NameXIAP associated factor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6463 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location72301629-72313733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72308638 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 67 (R67H)
Ref Sequence ENSEMBL: ENSMUSP00000121483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094041] [ENSMUST00000140842] [ENSMUST00000146233] [ENSMUST00000151440]
Predicted Effect probably benign
Transcript: ENSMUST00000094041
Predicted Effect probably benign
Transcript: ENSMUST00000140842
AA Change: R67H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121472
Gene: ENSMUSG00000040483
AA Change: R67H

DomainStartEndE-ValueType
PDB:2LXW|A 133 175 7e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142921
Predicted Effect probably benign
Transcript: ENSMUST00000146233
AA Change: R162H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123011
Gene: ENSMUSG00000040483
AA Change: R162H

DomainStartEndE-ValueType
PDB:2LXW|A 228 270 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000151440
AA Change: R67H

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000121483
Gene: ENSMUSG00000040483
AA Change: R67H

DomainStartEndE-ValueType
PDB:2LXW|A 133 165 7e-9 PDB
low complexity region 194 205 N/A INTRINSIC
Meta Mutation Damage Score 0.0552 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which binds to and counteracts the inhibitory effect of a member of the IAP (inhibitor of apoptosis) protein family. IAP proteins bind to and inhibit caspases which are activated during apoptosis. The proportion of IAPs and proteins which interfere with their activity, such as the encoded protein, affect the progress of the apoptosis signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Cep63 C A 9: 102,596,155 M504I probably benign Het
Chpf2 G T 5: 24,589,526 L231F probably damaging Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Dnm1 T C 2: 32,309,591 probably benign Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Fbp1 A G 13: 62,865,010 F123S possibly damaging Het
Hkdc1 T C 10: 62,393,702 N732S probably damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Oas2 T C 5: 120,734,981 R670G probably null Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Olfr698 C G 7: 106,752,801 E196Q probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
Slc6a20b T A 9: 123,604,949 I275F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trh A T 6: 92,242,843 M164K possibly damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Ttll7 G A 3: 146,931,582 R490Q possibly damaging Het
Uck1 T C 2: 32,258,655 N100S probably benign Het
Ucp3 A T 7: 100,480,269 T104S probably benign Het
Vmn2r28 T A 7: 5,486,436 H468L probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Zfp687 A G 3: 95,010,784 I559T probably damaging Het
Other mutations in Xaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02457:Xaf1 APN 11 72303431 missense possibly damaging 0.80
R0230:Xaf1 UTSW 11 72306555 intron probably benign
R1955:Xaf1 UTSW 11 72306606 missense possibly damaging 0.81
R2206:Xaf1 UTSW 11 72303402 missense possibly damaging 0.85
R2207:Xaf1 UTSW 11 72303402 missense possibly damaging 0.85
R4864:Xaf1 UTSW 11 72306856 intron probably benign
R5973:Xaf1 UTSW 11 72303430 missense probably damaging 0.98
R6786:Xaf1 UTSW 11 72306635 missense probably benign 0.00
R7199:Xaf1 UTSW 11 72303375 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGTCTTCTAGCGAAGTTAGCTG -3'
(R):5'- CCCAGACTTCAAAGGCAGAG -3'

Sequencing Primer
(F):5'- TCTTCAGGCTTGACAAGAAGC -3'
(R):5'- AGAGCCACAGTGCCATTTTG -3'
Posted On2018-05-21