Incidental Mutation 'R6463:Mtr'
ID517701
Institutional Source Beutler Lab
Gene Symbol Mtr
Ensembl Gene ENSMUSG00000021311
Gene Name5-methyltetrahydrofolate-homocysteine methyltransferase
Synonymsmethionine synthase, D830038K18Rik, MS
MMRRC Submission
Accession Numbers

Genbank: NM_001081128

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6463 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location12182712-12258113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12216866 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 651 (T651A)
Ref Sequence ENSEMBL: ENSMUSP00000097442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099856] [ENSMUST00000221290]
Predicted Effect probably benign
Transcript: ENSMUST00000099856
AA Change: T651A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097442
Gene: ENSMUSG00000021311
AA Change: T651A

DomainStartEndE-ValueType
Pfam:S-methyl_trans 18 326 1.5e-93 PFAM
Pfam:Pterin_bind 363 601 4.6e-63 PFAM
B12-binding_2 657 743 6.42e-41 SMART
Pfam:B12-binding 761 861 3.3e-20 PFAM
Pfam:Met_synt_B12 953 1234 2.5e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221290
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 5-methyltetrahydrofolate-homocysteine methyltransferase. This enzyme, also known as cobalamin-dependent methionine synthase, catalyzes the final step in methionine biosynthesis. Mutations in MTR have been identified as the underlying cause of methylcobalamin deficiency complementation group G. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit embryonic lethality prior to E9.5. Heterozygous appear mostly similar to conrtols, except that they exhibit elevated plasma methionine and homocysteine levels. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Cep63 C A 9: 102,596,155 M504I probably benign Het
Chpf2 G T 5: 24,589,526 L231F probably damaging Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Dnm1 T C 2: 32,309,591 probably benign Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Fbp1 A G 13: 62,865,010 F123S possibly damaging Het
Hkdc1 T C 10: 62,393,702 N732S probably damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Oas2 T C 5: 120,734,981 R670G probably null Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Olfr698 C G 7: 106,752,801 E196Q probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
Slc6a20b T A 9: 123,604,949 I275F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trh A T 6: 92,242,843 M164K possibly damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Ttll7 G A 3: 146,931,582 R490Q possibly damaging Het
Uck1 T C 2: 32,258,655 N100S probably benign Het
Ucp3 A T 7: 100,480,269 T104S probably benign Het
Vmn2r28 T A 7: 5,486,436 H468L probably benign Het
Xaf1 G A 11: 72,308,638 R67H probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Zfp687 A G 3: 95,010,784 I559T probably damaging Het
Other mutations in Mtr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Mtr APN 13 12225650 splice site probably benign
IGL02456:Mtr APN 13 12199094 missense probably damaging 0.98
IGL02573:Mtr APN 13 12199127 missense possibly damaging 0.95
IGL02642:Mtr APN 13 12195232 splice site probably benign
IGL03005:Mtr APN 13 12235449 splice site probably benign
IGL03017:Mtr APN 13 12247891 critical splice donor site probably null
IGL03036:Mtr APN 13 12247377 missense probably damaging 1.00
H8930:Mtr UTSW 13 12235460 missense probably damaging 1.00
PIT4431001:Mtr UTSW 13 12212443 missense probably damaging 1.00
PIT4520001:Mtr UTSW 13 12197985 nonsense probably null
R0011:Mtr UTSW 13 12238052 splice site probably benign
R0047:Mtr UTSW 13 12222226 missense probably damaging 1.00
R0047:Mtr UTSW 13 12222226 missense probably damaging 1.00
R0304:Mtr UTSW 13 12222154 critical splice donor site probably null
R0617:Mtr UTSW 13 12221432 missense probably benign
R0842:Mtr UTSW 13 12200247 missense probably damaging 1.00
R1101:Mtr UTSW 13 12189525 missense possibly damaging 0.84
R1450:Mtr UTSW 13 12193733 missense probably damaging 0.99
R1534:Mtr UTSW 13 12235544 splice site probably benign
R1907:Mtr UTSW 13 12225532 missense probably damaging 1.00
R2111:Mtr UTSW 13 12244601 missense possibly damaging 0.86
R2354:Mtr UTSW 13 12188157 splice site probably benign
R3849:Mtr UTSW 13 12247365 missense probably benign 0.16
R3899:Mtr UTSW 13 12216849 missense probably benign 0.00
R4012:Mtr UTSW 13 12189397 missense probably damaging 1.00
R4012:Mtr UTSW 13 12189398 missense probably damaging 1.00
R4075:Mtr UTSW 13 12215412 critical splice donor site probably null
R4091:Mtr UTSW 13 12231057 missense probably damaging 1.00
R4655:Mtr UTSW 13 12227793 missense probably damaging 1.00
R4801:Mtr UTSW 13 12195251 missense probably benign 0.01
R4802:Mtr UTSW 13 12195251 missense probably benign 0.01
R4895:Mtr UTSW 13 12216866 missense probably benign 0.01
R5481:Mtr UTSW 13 12188155 critical splice acceptor site probably null
R5966:Mtr UTSW 13 12215567 critical splice acceptor site probably null
R6209:Mtr UTSW 13 12190392 missense probably benign 0.00
R6348:Mtr UTSW 13 12247954 missense possibly damaging 0.49
R6467:Mtr UTSW 13 12188106 missense probably damaging 1.00
R7046:Mtr UTSW 13 12190209 missense possibly damaging 0.58
R7505:Mtr UTSW 13 12221476 missense probably benign 0.02
X0064:Mtr UTSW 13 12250657 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCCACACCCATCTATGAAG -3'
(R):5'- TGACTTCAGTCTTGATCCATGC -3'

Sequencing Primer
(F):5'- GACAGGCATCTCAGGTTAAAAATC -3'
(R):5'- AGTCTTGATCCATGCTGAACAC -3'
Posted On2018-05-21