Incidental Mutation 'R6464:Tesk2'
ID517726
Institutional Source Beutler Lab
Gene Symbol Tesk2
Ensembl Gene ENSMUSG00000033985
Gene Nametestis-specific kinase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R6464 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location116720948-116805956 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 116802849 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 388 (D388A)
Ref Sequence ENSEMBL: ENSMUSP00000102064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030451] [ENSMUST00000045542] [ENSMUST00000102699] [ENSMUST00000106455] [ENSMUST00000106456] [ENSMUST00000106459] [ENSMUST00000130359] [ENSMUST00000145468]
Predicted Effect probably benign
Transcript: ENSMUST00000030451
SMART Domains Protein: ENSMUSP00000030451
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 39 171 3.1e-46 PFAM
Pfam:CAF1 164 452 9.9e-40 PFAM
Pfam:zf-CCCH 297 322 2.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000045542
AA Change: D417A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041009
Gene: ENSMUSG00000033985
AA Change: D417A

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase 59 309 1.6e-48 PFAM
Pfam:Pkinase_Tyr 59 309 1.2e-50 PFAM
low complexity region 539 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102699
SMART Domains Protein: ENSMUSP00000099760
Gene: ENSMUSG00000028687

DomainStartEndE-ValueType
ENDO3c 107 259 1.46e-52 SMART
FES 260 280 2.16e-5 SMART
Pfam:NUDIX_4 353 463 2.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106455
SMART Domains Protein: ENSMUSP00000102063
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:CAF1 37 301 2.1e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106456
AA Change: D388A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102064
Gene: ENSMUSG00000033985
AA Change: D388A

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 291 4.5e-46 PFAM
Pfam:Pkinase 60 332 3.6e-46 PFAM
low complexity region 510 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106459
SMART Domains Protein: ENSMUSP00000102067
Gene: ENSMUSG00000033985

DomainStartEndE-ValueType
low complexity region 24 30 N/A INTRINSIC
Pfam:Pkinase_Tyr 59 238 6.1e-37 PFAM
Pfam:Pkinase 60 239 4.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124857
Predicted Effect probably benign
Transcript: ENSMUST00000130359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142529
Predicted Effect probably benign
Transcript: ENSMUST00000145468
SMART Domains Protein: ENSMUSP00000117019
Gene: ENSMUSG00000028688

DomainStartEndE-ValueType
Pfam:CAF1 1 184 2.2e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154945
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain that is structurally similar to the kinase domains of testis-specific protein kinase-1 and the LIM motif-containing protein kinases (LIMKs). Its overall structure is most related to the former, indicating that it belongs to the TESK subgroup of the LIMK/TESK family of protein kinases. This gene is predominantly expressed in testis and prostate. The developmental expression pattern of the rat gene in testis suggests an important role for this gene in meitoic stages and/or early stages of spermiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,447,490 S769T probably damaging Het
Apoe G A 7: 19,697,536 T52M probably damaging Het
Arhgef10l A C 4: 140,586,815 M230R probably benign Het
Cdkl4 A T 17: 80,525,352 I321N probably benign Het
Ceacam5 T C 7: 17,747,466 probably null Het
Cfap70 T C 14: 20,401,039 probably null Het
Clasp2 A G 9: 113,773,717 Y195C probably damaging Het
Clip2 T C 5: 134,491,925 I999V probably benign Het
Cntnap5a A G 1: 116,184,408 D476G probably benign Het
Col6a6 C T 9: 105,788,953 M1I probably null Het
Cyp27a1 T C 1: 74,735,888 V292A possibly damaging Het
Cyp2c29 A G 19: 39,329,225 Y385C probably damaging Het
Dsg3 A C 18: 20,533,526 R597S probably benign Het
Fam131c T C 4: 141,382,342 I95T probably damaging Het
Fam13b A T 18: 34,473,631 C302* probably null Het
Fkbp15 T C 4: 62,308,078 K745E possibly damaging Het
Flg T A 3: 93,281,381 probably benign Het
Gm11559 T C 11: 99,864,716 C64R unknown Het
Gm14025 T C 2: 129,039,545 T154A possibly damaging Het
Gm35339 A G 15: 76,362,777 T1413A probably benign Het
Helt T C 8: 46,292,534 D104G probably damaging Het
Helz2 T C 2: 181,235,069 T1211A probably benign Het
Ifna9 T C 4: 88,592,250 R46G possibly damaging Het
Kif20b G A 19: 34,934,441 V235I probably benign Het
Kif7 A G 7: 79,714,094 V22A possibly damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lipf A T 19: 33,973,544 Y305F probably benign Het
Lpar1 A G 4: 58,486,875 L132P possibly damaging Het
Magi1 A T 6: 93,699,789 V834E probably damaging Het
Meltf T C 16: 31,890,776 Y432H probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Myo1f T C 17: 33,576,647 L59P probably damaging Het
Naa25 G A 5: 121,417,961 D271N probably damaging Het
Olfr1038-ps A T 2: 86,122,408 I162F possibly damaging Het
Olfr1117-ps1 A T 2: 87,309,607 I273F probably damaging Het
Otoa A G 7: 121,102,605 Q169R probably damaging Het
Pde4dip C T 3: 97,710,344 D1723N probably damaging Het
Ptdss2 T C 7: 141,152,211 V175A probably damaging Het
Rdh8 G T 9: 20,823,400 R121L probably damaging Het
Rpl23 T C 11: 97,778,285 probably null Het
Scn5a T C 9: 119,534,580 D498G probably damaging Het
Slc39a14 G C 14: 70,306,728 L470V probably damaging Het
Smok2a C T 17: 13,226,430 A298V probably damaging Het
Tnik G A 3: 28,611,970 probably null Het
Ube3a T A 7: 59,276,183 Y236* probably null Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn1r74 A T 7: 11,847,204 I144L possibly damaging Het
Vmn2r1 G A 3: 64,101,345 D482N probably benign Het
Vwf T C 6: 125,639,400 probably null Het
Zfp703 C G 8: 26,979,327 P340A probably damaging Het
Znfx1 T C 2: 167,046,922 S789G probably benign Het
Other mutations in Tesk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Tesk2 APN 4 116771801 missense possibly damaging 0.68
IGL02051:Tesk2 APN 4 116751184 missense probably damaging 1.00
IGL02223:Tesk2 APN 4 116741825 nonsense probably null
IGL02747:Tesk2 APN 4 116802879 missense probably benign 0.31
IGL02942:Tesk2 APN 4 116771820 missense probably damaging 0.99
R1804:Tesk2 UTSW 4 116800621 unclassified probably benign
R1936:Tesk2 UTSW 4 116741824 missense probably benign 0.23
R1986:Tesk2 UTSW 4 116751193 missense probably damaging 1.00
R2414:Tesk2 UTSW 4 116801757 missense possibly damaging 0.96
R4632:Tesk2 UTSW 4 116741712 missense probably benign 0.01
R4896:Tesk2 UTSW 4 116802993 missense probably benign
R5186:Tesk2 UTSW 4 116741896 missense probably damaging 1.00
R5209:Tesk2 UTSW 4 116724698 start gained probably benign
R5278:Tesk2 UTSW 4 116805936 intron probably benign
R5769:Tesk2 UTSW 4 116802315 intron probably null
R6199:Tesk2 UTSW 4 116792170 missense probably damaging 0.98
R6567:Tesk2 UTSW 4 116792164 missense probably damaging 1.00
R6867:Tesk2 UTSW 4 116801798 missense probably damaging 0.99
R7028:Tesk2 UTSW 4 116802687 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGATGACAAGATTCCCCAC -3'
(R):5'- AGGCCCATCAGAGAGTGATTC -3'

Sequencing Primer
(F):5'- TGGATGACAAGATTCCCCACAAGTC -3'
(R):5'- TGATTCTTCACAGCCCATAAATG -3'
Posted On2018-05-21