Incidental Mutation 'R6465:Haghl'
ID517797
Institutional Source Beutler Lab
Gene Symbol Haghl
Ensembl Gene ENSMUSG00000061046
Gene Namehydroxyacylglutathione hydrolase-like
Synonyms2810014I23Rik, 1500017E18Rik, C330022E15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6465 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25779843-25785673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25783819 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 190 (N190S)
Ref Sequence ENSEMBL: ENSMUSP00000119647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002350] [ENSMUST00000077938] [ENSMUST00000095500] [ENSMUST00000131458] [ENSMUST00000133071] [ENSMUST00000134108] [ENSMUST00000138759] [ENSMUST00000140738] [ENSMUST00000145053] [ENSMUST00000150324]
Predicted Effect probably benign
Transcript: ENSMUST00000002350
SMART Domains Protein: ENSMUSP00000002350
Gene: ENSMUSG00000002280

DomainStartEndE-ValueType
Pfam:Fe_hyd_lg_C 110 406 8.5e-95 PFAM
Fe_hyd_SSU 410 466 9.56e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000077938
AA Change: N190S

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077091
Gene: ENSMUSG00000061046
AA Change: N190S

DomainStartEndE-ValueType
Lactamase_B 11 173 7.63e-25 SMART
Pfam:HAGH_C 174 270 3.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095500
SMART Domains Protein: ENSMUSP00000093155
Gene: ENSMUSG00000071202

DomainStartEndE-ValueType
Pfam:DUF4472 63 190 5.5e-23 PFAM
coiled coil region 364 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130861
Predicted Effect probably benign
Transcript: ENSMUST00000131458
SMART Domains Protein: ENSMUSP00000120281
Gene: ENSMUSG00000002280

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133071
AA Change: N142S

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120885
Gene: ENSMUSG00000061046
AA Change: N142S

DomainStartEndE-ValueType
Lactamase_B 1 125 1.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134108
SMART Domains Protein: ENSMUSP00000117136
Gene: ENSMUSG00000002280

DomainStartEndE-ValueType
Pfam:Fe_hyd_lg_C 110 422 4e-85 PFAM
Fe_hyd_SSU 426 482 9.56e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138100
Predicted Effect possibly damaging
Transcript: ENSMUST00000138759
AA Change: N142S

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115538
Gene: ENSMUSG00000061046
AA Change: N142S

DomainStartEndE-ValueType
Lactamase_B 1 125 1.34e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140738
AA Change: N190S

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116841
Gene: ENSMUSG00000061046
AA Change: N190S

DomainStartEndE-ValueType
Lactamase_B 11 173 7.63e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143248
Predicted Effect probably benign
Transcript: ENSMUST00000145053
SMART Domains Protein: ENSMUSP00000114961
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Pfam:Lactamase_B 7 113 3.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149645
Predicted Effect possibly damaging
Transcript: ENSMUST00000150324
AA Change: N190S

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119647
Gene: ENSMUSG00000061046
AA Change: N190S

DomainStartEndE-ValueType
Lactamase_B 11 173 7.63e-25 SMART
Pfam:HAGH_C 174 270 3.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183975
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik A T 9: 35,908,625 N25Y possibly damaging Het
A2ml1 G A 6: 128,541,078 T1415I probably damaging Het
Acvr2b T A 9: 119,433,303 W461R probably damaging Het
Adam23 G T 1: 63,566,668 C637F probably damaging Het
Apol8 T G 15: 77,749,948 T143P probably benign Het
Asna1 A T 8: 85,018,565 M291K probably benign Het
Bfsp1 A C 2: 143,858,055 probably null Het
Cytl1 T C 5: 37,737,670 V99A probably benign Het
Dock2 A T 11: 34,503,413 V793E probably damaging Het
Fxyd5 G T 7: 31,037,880 T81K probably damaging Het
Gcm1 A G 9: 78,064,869 Y364C probably damaging Het
Gm37596 A G 3: 93,692,996 I22T probably damaging Het
Gm9992 G T 17: 7,374,443 T202K probably damaging Het
Inpp5j C A 11: 3,502,293 R319L possibly damaging Het
Ints10 A G 8: 68,807,536 N304S probably benign Het
Isoc1 T A 18: 58,671,256 C119S probably damaging Het
Klhl18 A G 9: 110,428,920 M414T probably benign Het
Krtap2-4 A G 11: 99,614,759 probably benign Het
Krtap3-1 G A 11: 99,566,451 P45S possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A G 7: 98,062,680 V1754A possibly damaging Het
Nedd4l T A 18: 65,155,264 D119E probably benign Het
Nsun7 T C 5: 66,295,586 V548A probably benign Het
Olfr1024 A T 2: 85,904,539 S172T probably benign Het
Olfr711 A T 7: 106,972,212 V44E possibly damaging Het
Parvg A G 15: 84,328,940 D127G probably damaging Het
Piezo2 T A 18: 63,041,663 M2007L possibly damaging Het
Pou2f3 A C 9: 43,139,867 F175V probably damaging Het
Ptprn2 T C 12: 117,269,589 I958T probably damaging Het
Pwwp2b T C 7: 139,256,035 V464A probably benign Het
Pzp A G 6: 128,491,619 Y982H probably damaging Het
Rad17 T A 13: 100,637,080 N202I probably benign Het
Rtel1 T A 2: 181,335,940 D271E possibly damaging Het
Sos2 T C 12: 69,596,775 S943G probably benign Het
Tm9sf2 A G 14: 122,141,207 H241R probably benign Het
Ttc8 A G 12: 98,964,570 E291G probably damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Ylpm1 T A 12: 85,049,802 D1219E probably damaging Het
Zc3hav1 T C 6: 38,331,849 Y586C possibly damaging Het
Zcchc4 T A 5: 52,819,276 F471I probably benign Het
Zfp719 C A 7: 43,590,684 Y565* probably null Het
Other mutations in Haghl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Haghl APN 17 25784265 missense probably damaging 1.00
IGL02309:Haghl APN 17 25784664 missense probably damaging 1.00
IGL02458:Haghl APN 17 25783496 splice site probably benign
IGL02480:Haghl APN 17 25783059 missense probably damaging 1.00
IGL02884:Haghl APN 17 25783098 missense possibly damaging 0.53
R2939:Haghl UTSW 17 25785086 missense possibly damaging 0.57
R2940:Haghl UTSW 17 25785086 missense possibly damaging 0.57
R4458:Haghl UTSW 17 25785020 missense probably damaging 0.99
R4850:Haghl UTSW 17 25783006 utr 3 prime probably benign
X0065:Haghl UTSW 17 25784679 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCTGCAAAGCACAGAAG -3'
(R):5'- CCTGTCCTGCTTTGGTAAAGG -3'

Sequencing Primer
(F):5'- GTTACGGCACAGCAGGG -3'
(R):5'- CCTGCTTTGGTAAAGGTGGTG -3'
Posted On2018-05-21