Incidental Mutation 'R6481:Atad3a'
ID517818
Institutional Source Beutler Lab
Gene Symbol Atad3a
Ensembl Gene ENSMUSG00000029036
Gene NameATPase family, AAA domain containing 3A
SynonymsTob3, 2400004H09Rik
MMRRC Submission
Accession Numbers

Genbank: NM_179203; MGI:1919214

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6481 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location155740641-155761093 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 155753641 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030903] [ENSMUST00000176043] [ENSMUST00000184913]
Predicted Effect probably null
Transcript: ENSMUST00000030903
SMART Domains Protein: ENSMUSP00000030903
Gene: ENSMUSG00000029036

DomainStartEndE-ValueType
Pfam:DUF3523 26 285 9.5e-113 PFAM
AAA 343 482 4.43e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134317
Predicted Effect probably benign
Transcript: ENSMUST00000175679
Predicted Effect probably benign
Transcript: ENSMUST00000176043
SMART Domains Protein: ENSMUSP00000135405
Gene: ENSMUSG00000029036

DomainStartEndE-ValueType
Pfam:DUF3523 20 193 5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177066
Predicted Effect probably benign
Transcript: ENSMUST00000184131
Predicted Effect probably benign
Transcript: ENSMUST00000184913
SMART Domains Protein: ENSMUSP00000138808
Gene: ENSMUSG00000029036

DomainStartEndE-ValueType
Pfam:DUF3523 1 125 9.9e-43 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed mitochondrial membrane protein that contributes to mitochondrial dynamics, nucleoid organization, protein translation, cell growth, and cholesterol metabolism. This gene is a member of the ATPase family AAA-domain containing 3 gene family which, in humans, includes two other paralogs. Naturally occurring mutations in this gene are associated with distinct neurological syndromes including Harel-Yoon syndrome. High-level expression of this gene is associated with poor survival in breast cancer patients. A homozygous knockout of the orthologous gene in mice results in embryonic lethality at day 7.5 due to growth retardation and defective development of the trophoblast lineage. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a gene trapped allele die around E7.5 exhibiting growth retardation, failure to gastrulate, and impaired development of the trophoblast lineage immediately after implantation. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, other(2) Gene trapped(6)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428L18Rik T C 1: 31,222,507 probably benign Het
5430419D17Rik A T 7: 131,256,801 D1066V probably benign Het
6430573F11Rik T C 8: 36,498,483 probably null Het
Abca9 G A 11: 110,165,962 Q11* probably null Het
Abcc9 A T 6: 142,604,895 M1273K probably damaging Het
Abi2 A G 1: 60,438,939 probably null Het
Acsm5 A G 7: 119,534,881 E295G probably benign Het
Anapc5 T C 5: 122,800,544 D389G probably benign Het
Ano3 A T 2: 110,795,027 D159E probably benign Het
Arhgap26 T A 18: 39,150,057 M349K probably damaging Het
Arhgef39 A G 4: 43,498,580 probably null Het
Astn1 T C 1: 158,612,462 S867P probably benign Het
Cadm1 A T 9: 47,788,109 D91V probably damaging Het
Cc2d2b T C 19: 40,802,395 I933T possibly damaging Het
Celsr3 C G 9: 108,837,084 N1937K possibly damaging Het
Cic A C 7: 25,288,281 T558P possibly damaging Het
Cntln A G 4: 85,067,510 M933V probably benign Het
Coch T C 12: 51,598,173 F170S probably damaging Het
Col1a2 A G 6: 4,538,680 Y1200C unknown Het
Col26a1 T C 5: 136,744,178 M383V probably benign Het
Col4a4 A T 1: 82,453,778 M1595K unknown Het
Crh T C 3: 19,694,337 E47G probably benign Het
Cyhr1 T C 15: 76,658,708 probably null Het
D930020B18Rik T C 10: 121,661,148 probably null Het
Def6 G A 17: 28,226,163 R482H probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dpagt1 T C 9: 44,331,190 L241P probably damaging Het
E2f7 A G 10: 110,774,681 E389G probably damaging Het
Eif2b1 T C 5: 124,577,111 I53V probably benign Het
Fbxo4 A G 15: 3,965,734 L376P probably damaging Het
Fgfr2 A G 7: 130,185,278 S352P possibly damaging Het
Fkbpl C A 17: 34,645,414 P52Q possibly damaging Het
Fry G A 5: 150,386,014 R641H probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm12728 A G 4: 105,794,349 K52R probably damaging Het
Gm8298 T C 3: 59,861,057 Y3H probably benign Het
Gtf2a1l A G 17: 88,711,625 D379G probably benign Het
Gys1 A T 7: 45,442,969 Y332F possibly damaging Het
Hoxa7 T A 6: 52,216,614 probably benign Het
Ifitm1 G A 7: 140,969,606 V101I probably benign Het
Kalrn T A 16: 34,360,984 T95S probably damaging Het
Leng8 A G 7: 4,145,413 Y728C probably damaging Het
Lonp2 G T 8: 86,634,908 D238Y possibly damaging Het
Ltn1 A C 16: 87,378,980 S1757A probably damaging Het
Man2a2 A T 7: 80,364,071 S411T probably damaging Het
Mrps33 C A 6: 39,805,370 probably null Het
Muc16 C T 9: 18,550,677 probably null Het
Muc5ac A G 7: 141,809,071 probably benign Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Olfr1141 T C 2: 87,753,468 N175S probably damaging Het
Olfr1204 A T 2: 88,852,519 T190S probably damaging Het
Olfr122 T G 17: 37,772,303 F217V probably damaging Het
Olfr1340 A G 4: 118,726,733 Y162C probably damaging Het
Olfr50 T A 2: 36,793,777 D180E possibly damaging Het
Olfr545 A T 7: 102,494,139 V212D probably damaging Het
Pag1 T A 3: 9,699,336 E252D possibly damaging Het
Plcd3 T C 11: 103,077,767 Y366C probably damaging Het
Psg17 A C 7: 18,814,450 S465R probably damaging Het
Ptpn9 G T 9: 57,023,040 V50L probably damaging Het
Rab17 T G 1: 90,958,961 S190R probably benign Het
Samd11 A G 4: 156,249,078 probably null Het
Slc17a5 A G 9: 78,538,271 F434S possibly damaging Het
Slc22a15 A G 3: 101,883,583 I202T possibly damaging Het
Slc8a1 G T 17: 81,388,918 Q896K probably benign Het
Slc9a5 A T 8: 105,358,393 K509* probably null Het
Slf2 A C 19: 44,973,164 M1041L probably benign Het
Smn1 A G 13: 100,128,500 probably null Het
Snx9 T C 17: 5,922,209 probably null Het
Soat2 T A 15: 102,162,055 L431Q probably damaging Het
Spam1 T A 6: 24,796,930 N293K probably benign Het
Tatdn1 T C 15: 58,923,911 T66A possibly damaging Het
Tmprss11g A T 5: 86,492,156 S205T probably benign Het
Tnpo3 G T 6: 29,571,101 N431K possibly damaging Het
Trim39 T C 17: 36,268,662 T31A probably benign Het
Tshz3 A G 7: 36,752,339 probably null Het
Ttll11 G A 2: 35,902,754 T359M probably damaging Het
Ttn T G 2: 76,741,499 D26350A probably damaging Het
Ubr4 G T 4: 139,431,751 V2472F probably damaging Het
Vsx2 C T 12: 84,593,104 P265S probably benign Het
Wdr90 C T 17: 25,845,911 G1708R probably damaging Het
Wnt11 A G 7: 98,853,274 Y351C probably damaging Het
Xpo6 A C 7: 126,112,885 N3K probably damaging Het
Zfp445 A G 9: 122,857,566 S165P probably benign Het
Zfp953 A T 13: 67,347,937 Y13* probably null Het
Other mutations in Atad3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Atad3a APN 4 155746078 missense probably damaging 0.98
IGL01982:Atad3a APN 4 155753927 missense possibly damaging 0.94
IGL02059:Atad3a APN 4 155754750 splice site probably benign
IGL02572:Atad3a APN 4 155753584 missense possibly damaging 0.61
IGL03086:Atad3a APN 4 155748670 critical splice donor site probably null
IGL03409:Atad3a APN 4 155747350 missense probably damaging 0.99
E2594:Atad3a UTSW 4 155750933 unclassified probably benign
FR4976:Atad3a UTSW 4 155753939 missense probably damaging 0.98
PIT4618001:Atad3a UTSW 4 155750138 missense probably benign 0.41
R0233:Atad3a UTSW 4 155746067 missense probably damaging 0.99
R0233:Atad3a UTSW 4 155746067 missense probably damaging 0.99
R0601:Atad3a UTSW 4 155747407 missense probably damaging 1.00
R0799:Atad3a UTSW 4 155747470 missense probably damaging 1.00
R1428:Atad3a UTSW 4 155755682 missense probably damaging 1.00
R1597:Atad3a UTSW 4 155751435 critical splice donor site probably null
R2188:Atad3a UTSW 4 155751519 missense probably damaging 0.99
R4126:Atad3a UTSW 4 155754061 splice site probably benign
R4564:Atad3a UTSW 4 155747309 splice site probably null
R5334:Atad3a UTSW 4 155755689 missense probably damaging 1.00
R6354:Atad3a UTSW 4 155753945 missense possibly damaging 0.58
R7220:Atad3a UTSW 4 155754041 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTCCCTTATCTGAGCTGGC -3'
(R):5'- AGTCCCTGAAGGTCATGAAGGG -3'

Sequencing Primer
(F):5'- GTATCTGCAAGATATCAGGTGTCCC -3'
(R):5'- CTGAAGGTCATGAAGGGCCTCTATC -3'
Posted On2018-05-21