Incidental Mutation 'R6484:Lrig3'
ID517823
Institutional Source Beutler Lab
Gene Symbol Lrig3
Ensembl Gene ENSMUSG00000020105
Gene Nameleucine-rich repeats and immunoglobulin-like domains 3
Synonyms9030421L11Rik, 9430095K15Rik, 9130004I02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R6484 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location125966168-126015359 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 125996609 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074807]
PDB Structure
Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000074807
SMART Domains Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 46 78 6.74e-2 SMART
LRR 72 96 4.45e1 SMART
LRR 97 120 1.06e1 SMART
LRR 144 166 1.14e0 SMART
LRR 168 189 1.62e2 SMART
LRR 190 214 1.09e1 SMART
LRR 215 237 1.71e1 SMART
LRR 238 261 2.29e0 SMART
LRR 262 285 3.07e-1 SMART
LRR 286 309 2.49e-1 SMART
LRR 310 333 1.29e1 SMART
LRR 334 357 6.22e0 SMART
LRR 358 384 6.05e0 SMART
LRR_TYP 385 408 1.56e-2 SMART
LRR_TYP 409 432 1.79e-2 SMART
LRRCT 444 494 2.35e-7 SMART
IGc2 511 588 1.65e-4 SMART
IGc2 615 683 1.33e-8 SMART
IGc2 709 774 2.78e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220332
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.7%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,279,095 V1548A probably damaging Het
3110062M04Rik G A 6: 34,874,616 S101L probably damaging Het
Abce1 A T 8: 79,690,323 M353K probably damaging Het
Adgre4 G A 17: 55,802,036 V348M possibly damaging Het
Alg8 T C 7: 97,382,928 V228A probably benign Het
Btbd8 T C 5: 107,503,585 S115P probably benign Het
Car8 A G 4: 8,189,362 F151L probably benign Het
CN725425 A G 15: 91,260,572 Q546R probably benign Het
Col17a1 C T 19: 47,670,429 V414M possibly damaging Het
Col6a3 C A 1: 90,791,923 probably null Het
Cyp51 G A 5: 4,086,627 T389M probably benign Het
Dazap1 A G 10: 80,277,647 T126A probably benign Het
Dscc1 T A 15: 55,080,290 K395* probably null Het
Dthd1 A G 5: 62,814,332 N166S probably benign Het
Eefsec C G 6: 88,297,788 W398S probably damaging Het
Enpep T A 3: 129,321,481 H214L probably damaging Het
Esf1 T C 2: 140,158,538 I443V probably benign Het
Espl1 T C 15: 102,323,500 V1984A possibly damaging Het
Hip1 A G 5: 135,440,129 S280P probably damaging Het
Il12rb1 C T 8: 70,809,704 probably null Het
Itgax T A 7: 128,133,718 C255S probably benign Het
Kifc5b T C 17: 26,924,772 V506A probably damaging Het
Klf3 A G 5: 64,823,029 E54G probably damaging Het
Mctp1 A G 13: 76,688,625 I104V probably benign Het
Mdga2 T C 12: 66,630,069 E552G possibly damaging Het
Mpc1 A G 17: 8,296,956 E160G possibly damaging Het
Myh10 T A 11: 68,699,467 I76N probably damaging Het
Myh7b A T 2: 155,628,643 I1032F probably benign Het
Olfml2a G A 2: 38,959,768 V499I probably damaging Het
Olfr1311 A T 2: 112,021,419 L145* probably null Het
Olfr1458 A G 19: 13,103,067 V79A probably benign Het
Olfr91 T A 17: 37,093,266 I203F probably benign Het
P2ry12 A G 3: 59,217,333 L307P probably damaging Het
Pappa C A 4: 65,314,659 A1345D probably damaging Het
Phox2b A G 5: 67,097,701 I135T possibly damaging Het
Poln C T 5: 34,129,513 A104T probably benign Het
Prkce A G 17: 86,490,809 D342G probably benign Het
Ptchd3 T A 11: 121,842,938 F885I possibly damaging Het
Rcbtb2 A T 14: 73,177,050 S434C probably damaging Het
Rfc1 A G 5: 65,293,677 V356A probably benign Het
Rln1 A G 19: 29,334,502 F32S probably benign Het
Ryr2 A G 13: 11,662,383 L3194P possibly damaging Het
Sat2 T C 11: 69,622,527 V34A probably damaging Het
Scgb3a2 T C 18: 43,766,719 I24T possibly damaging Het
Slc35e2 T G 4: 155,612,647 V206G probably damaging Het
Slit3 A T 11: 35,661,298 M890L probably benign Het
Sorl1 A G 9: 41,976,407 L2042P probably damaging Het
Ssbp1 T A 6: 40,474,666 V9E probably damaging Het
Tbc1d23 C T 16: 57,178,016 V520M probably damaging Het
Thumpd2 T C 17: 81,054,188 E203G probably benign Het
Tlr11 A G 14: 50,362,678 D707G probably damaging Het
Tlr12 T A 4: 128,616,054 D801V probably damaging Het
Tnrc6b T G 15: 80,879,324 N342K possibly damaging Het
Vmn1r191 A C 13: 22,178,748 F279V probably benign Het
Vmn2r13 A T 5: 109,156,674 C630* probably null Het
Zbtb1 C T 12: 76,385,891 T217I probably damaging Het
Zfp385b ATCTTCTTCTTCT ATCTTCTTCTTCTTCT 2: 77,719,648 probably benign Het
Zzef1 C T 11: 72,895,271 P2090S probably damaging Het
Other mutations in Lrig3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lrig3 APN 10 126013148 missense probably benign 0.00
IGL00426:Lrig3 APN 10 125972137 nonsense probably null
IGL00969:Lrig3 APN 10 125997115 missense probably damaging 1.00
IGL01376:Lrig3 APN 10 125994466 missense probably benign 0.01
IGL01510:Lrig3 APN 10 126008698 missense probably damaging 1.00
IGL01825:Lrig3 APN 10 126010017 missense probably damaging 0.98
IGL02231:Lrig3 APN 10 125997172 missense probably damaging 1.00
IGL02377:Lrig3 APN 10 126014874 missense probably benign 0.00
IGL02648:Lrig3 APN 10 125966594 missense probably benign
IGL02832:Lrig3 APN 10 126007002 missense probably benign 0.37
IGL03266:Lrig3 APN 10 126013282 missense probably benign 0.28
R0023:Lrig3 UTSW 10 126010219 missense probably damaging 1.00
R0129:Lrig3 UTSW 10 126006943 missense probably damaging 1.00
R0183:Lrig3 UTSW 10 126010192 missense probably damaging 1.00
R0226:Lrig3 UTSW 10 125972117 splice site probably benign
R0233:Lrig3 UTSW 10 126013526 splice site probably null
R0233:Lrig3 UTSW 10 126013526 splice site probably null
R0336:Lrig3 UTSW 10 125966705 missense probably benign 0.04
R0348:Lrig3 UTSW 10 126013448 nonsense probably null
R0502:Lrig3 UTSW 10 126008736 missense probably damaging 1.00
R0639:Lrig3 UTSW 10 126010221 missense probably damaging 1.00
R1099:Lrig3 UTSW 10 126007014 splice site probably null
R1220:Lrig3 UTSW 10 125997076 missense probably damaging 1.00
R1230:Lrig3 UTSW 10 126002971 missense probably damaging 1.00
R1398:Lrig3 UTSW 10 126003088 missense probably benign 0.00
R1451:Lrig3 UTSW 10 126010057 missense possibly damaging 0.92
R1523:Lrig3 UTSW 10 126008698 missense probably damaging 1.00
R1545:Lrig3 UTSW 10 126008547 missense possibly damaging 0.80
R1661:Lrig3 UTSW 10 125997701 missense probably benign 0.12
R1665:Lrig3 UTSW 10 125997701 missense probably benign 0.12
R1673:Lrig3 UTSW 10 126010167 missense probably damaging 1.00
R1778:Lrig3 UTSW 10 126010075 missense probably damaging 1.00
R1800:Lrig3 UTSW 10 125997051 splice site probably null
R1840:Lrig3 UTSW 10 126013389 nonsense probably null
R1882:Lrig3 UTSW 10 126009825 missense possibly damaging 0.89
R1900:Lrig3 UTSW 10 126002393 splice site probably benign
R2160:Lrig3 UTSW 10 125997696 missense possibly damaging 0.95
R2200:Lrig3 UTSW 10 125996609 splice site probably null
R2294:Lrig3 UTSW 10 125966494 nonsense probably null
R2518:Lrig3 UTSW 10 125994441 missense probably benign 0.07
R3037:Lrig3 UTSW 10 126010032 missense probably damaging 1.00
R3236:Lrig3 UTSW 10 125997187 missense probably damaging 1.00
R4073:Lrig3 UTSW 10 126013408 missense probably benign
R4074:Lrig3 UTSW 10 126013408 missense probably benign
R4075:Lrig3 UTSW 10 126013408 missense probably benign
R4077:Lrig3 UTSW 10 126009787 missense probably damaging 1.00
R4079:Lrig3 UTSW 10 126009787 missense probably damaging 1.00
R4405:Lrig3 UTSW 10 126011008 missense probably benign 0.00
R4425:Lrig3 UTSW 10 126013404 missense probably benign 0.00
R4505:Lrig3 UTSW 10 126013347 missense probably benign 0.00
R4860:Lrig3 UTSW 10 126011052 missense probably benign 0.36
R4860:Lrig3 UTSW 10 126011052 missense probably benign 0.36
R4903:Lrig3 UTSW 10 125996613 critical splice acceptor site probably null
R5201:Lrig3 UTSW 10 126013151 missense possibly damaging 0.48
R5307:Lrig3 UTSW 10 126006690 missense probably damaging 1.00
R5402:Lrig3 UTSW 10 126008740 missense probably damaging 1.00
R5557:Lrig3 UTSW 10 125972134 missense probably damaging 1.00
R5792:Lrig3 UTSW 10 126009919 missense probably damaging 1.00
R5903:Lrig3 UTSW 10 126008478 missense probably damaging 1.00
R6280:Lrig3 UTSW 10 126010979 missense probably benign 0.18
R6985:Lrig3 UTSW 10 126014869 missense possibly damaging 0.64
R7089:Lrig3 UTSW 10 125997124 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTCCCTGTAATAAATTGGAGGG -3'
(R):5'- TACCAGGTGTCCACTCAGTATTTG -3'

Sequencing Primer
(F):5'- GTTTTAGCACTGACTGGG -3'
(R):5'- ATCTGAGTGGGAACTTCGGTAACC -3'
Posted On2018-05-21