Incidental Mutation 'R6415:Zswim5'
ID517852
Institutional Source Beutler Lab
Gene Symbol Zswim5
Ensembl Gene ENSMUSG00000033948
Gene Namezinc finger SWIM-type containing 5
Synonyms4933426E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6415 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location116877376-116989264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116980866 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 798 (F798L)
Ref Sequence ENSEMBL: ENSMUSP00000049474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044823]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044823
AA Change: F798L

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049474
Gene: ENSMUSG00000033948
AA Change: F798L

DomainStartEndE-ValueType
low complexity region 35 56 N/A INTRINSIC
low complexity region 119 182 N/A INTRINSIC
low complexity region 692 708 N/A INTRINSIC
low complexity region 982 995 N/A INTRINSIC
Meta Mutation Damage Score 0.258 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,699,972 F328L probably benign Het
4930563M21Rik G A 9: 55,974,012 T482M probably benign Het
9030624J02Rik T C 7: 118,792,646 W494R probably damaging Het
Adam9 A G 8: 24,978,482 Y513H probably damaging Het
Adamts20 C T 15: 94,324,659 probably null Het
B3gnt5 A G 16: 19,770,009 D326G probably damaging Het
Cacna1g A G 11: 94,463,417 I224T probably damaging Het
Ccdc18 A G 5: 108,161,746 I402M probably benign Het
Cckar A T 5: 53,703,056 C73S probably damaging Het
Cdk13 C T 13: 17,739,154 R880H probably damaging Het
Col1a1 A G 11: 94,940,160 N218D unknown Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp2c69 A G 19: 39,842,921 F483L probably benign Het
Ddx60 A G 8: 61,983,905 D963G probably benign Het
Dhx8 G T 11: 101,737,687 A142S unknown Het
Dock7 C T 4: 98,992,448 R926Q probably damaging Het
Dscaml1 C T 9: 45,683,677 Q693* probably null Het
Dysf G A 6: 84,140,042 C1234Y probably damaging Het
Ercc1 G A 7: 19,355,177 probably null Het
Fam91a1 T C 15: 58,442,917 L549P probably damaging Het
Fxyd2 T A 9: 45,403,294 Y5N possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gpr182 T A 10: 127,750,506 D192V possibly damaging Het
Gps1 T C 11: 120,787,722 V286A possibly damaging Het
Grk1 A G 8: 13,413,127 Y383C probably damaging Het
Hic1 G A 11: 75,166,317 P582L possibly damaging Het
Hist1h2bn T C 13: 21,754,486 Y122H probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Lactb T C 9: 66,970,645 K301E possibly damaging Het
Lrp3 A T 7: 35,204,168 V251E probably benign Het
Mapt G A 11: 104,298,998 G265S probably benign Het
Obscn A T 11: 59,035,130 D6245E probably damaging Het
Olfr118 G T 17: 37,672,557 C178F possibly damaging Het
Olfr1257 T C 2: 89,880,862 L12P probably damaging Het
Olfr1273-ps T A 2: 90,296,037 I275F probably damaging Het
Olfr340 A G 2: 36,452,605 S7G probably damaging Het
Olfr58 T A 9: 19,783,748 I205N probably damaging Het
Olfr777 T C 10: 129,269,021 T101A probably benign Het
Olfr832 T C 9: 18,945,119 L157P probably damaging Het
Oxsm A T 14: 16,241,904 H288Q probably benign Het
Pcdh9 C T 14: 93,015,842 M1128I possibly damaging Het
Pcdha8 T C 18: 36,994,561 Y699H probably damaging Het
Pgk2 A T 17: 40,207,568 I323N probably benign Het
Plin4 A G 17: 56,103,264 V1216A probably damaging Het
Ppargc1a T C 5: 51,462,834 probably benign Het
Ppil2 A G 16: 17,103,574 probably null Het
Prelp A T 1: 133,912,778 I322N probably benign Het
Prelp A T 1: 133,914,657 I250N probably damaging Het
Prss27 T A 17: 24,042,908 C63* probably null Het
Rab38 G A 7: 88,430,540 A47T possibly damaging Het
Rprd2 G A 3: 95,774,219 A436V probably benign Het
Sacs A T 14: 61,205,359 N1618I probably damaging Het
Scp2 T G 4: 108,105,140 S63R probably benign Het
Sftpb T G 6: 72,304,649 W9G probably damaging Het
Slco1a4 A T 6: 141,834,689 L125* probably null Het
Sptlc1 T C 13: 53,351,692 probably null Het
Sub1 T A 15: 11,986,474 M96L probably benign Het
Tanc1 T C 2: 59,837,114 V1233A probably benign Het
Tmem140 A T 6: 34,872,723 D58V probably damaging Het
Tmem231 G A 8: 111,926,892 probably benign Het
Tpt1 T C 14: 75,846,371 Y91H probably benign Het
Trap1 C T 16: 4,043,992 R636H possibly damaging Het
Ttc14 A G 3: 33,803,575 H275R possibly damaging Het
Zbtb44 T A 9: 31,064,214 I380N possibly damaging Het
Zcchc6 T A 13: 59,816,296 probably null Het
Other mutations in Zswim5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Zswim5 APN 4 116985736 missense possibly damaging 0.93
IGL01700:Zswim5 APN 4 116986461 unclassified probably benign
IGL01975:Zswim5 APN 4 116965692 missense probably benign 0.03
IGL02334:Zswim5 APN 4 116986644 missense probably damaging 1.00
IGL02505:Zswim5 APN 4 116962552 missense probably benign 0.43
IGL02712:Zswim5 APN 4 116985695 missense probably damaging 0.99
PIT4243001:Zswim5 UTSW 4 116984778 missense probably benign 0.10
R0324:Zswim5 UTSW 4 116986906 missense probably damaging 1.00
R0611:Zswim5 UTSW 4 116986677 unclassified probably null
R0730:Zswim5 UTSW 4 116985746 missense possibly damaging 0.75
R1663:Zswim5 UTSW 4 116986895 missense probably damaging 1.00
R1843:Zswim5 UTSW 4 116877699 missense unknown
R2070:Zswim5 UTSW 4 116979912 missense probably benign 0.14
R2176:Zswim5 UTSW 4 116973041 missense probably damaging 0.99
R3715:Zswim5 UTSW 4 116962558 missense probably benign 0.21
R4044:Zswim5 UTSW 4 116986702 missense probably damaging 1.00
R4063:Zswim5 UTSW 4 116877980 missense unknown
R4118:Zswim5 UTSW 4 116986819 missense possibly damaging 0.93
R4612:Zswim5 UTSW 4 116986704 missense probably damaging 1.00
R4782:Zswim5 UTSW 4 116972972 missense probably benign 0.00
R4799:Zswim5 UTSW 4 116972972 missense probably benign 0.00
R4983:Zswim5 UTSW 4 116985686 missense possibly damaging 0.60
R5294:Zswim5 UTSW 4 116979577 missense possibly damaging 0.93
R5836:Zswim5 UTSW 4 116984803 missense probably benign 0.27
R6025:Zswim5 UTSW 4 116950909 missense probably damaging 1.00
R6041:Zswim5 UTSW 4 116962621 missense probably benign 0.01
R6042:Zswim5 UTSW 4 116962621 missense probably benign 0.01
R6043:Zswim5 UTSW 4 116962621 missense probably benign 0.01
R6159:Zswim5 UTSW 4 116979679 missense probably damaging 1.00
R6198:Zswim5 UTSW 4 116878007 missense probably benign 0.13
R6442:Zswim5 UTSW 4 116951005 missense probably damaging 1.00
R6547:Zswim5 UTSW 4 116986903 missense probably damaging 1.00
R6616:Zswim5 UTSW 4 116986741 missense possibly damaging 0.93
R6745:Zswim5 UTSW 4 116975204 missense probably damaging 1.00
R7144:Zswim5 UTSW 4 116975976 critical splice donor site probably null
R7260:Zswim5 UTSW 4 116962646 missense probably damaging 1.00
R7300:Zswim5 UTSW 4 116975905 missense probably damaging 1.00
R7310:Zswim5 UTSW 4 116984688 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTTCTCCCCAGCAGAAAGC -3'
(R):5'- TAGTCTGACCCAGGTGCTATTCC -3'

Sequencing Primer
(F):5'- GCAGAAAGCAAACTTCCCTAAAGG -3'
(R):5'- CCAGGTGCTATTCCTAATGAACAGTC -3'
Posted On2018-05-24