Incidental Mutation 'R6415:Grk1'
ID517865
Institutional Source Beutler Lab
Gene Symbol Grk1
Ensembl Gene ENSMUSG00000031450
Gene NameG protein-coupled receptor kinase 1
SynonymsRK, Rhok
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6415 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location13405081-13421951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13413127 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 383 (Y383C)
Ref Sequence ENSEMBL: ENSMUSP00000147484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033827] [ENSMUST00000209909]
Predicted Effect probably damaging
Transcript: ENSMUST00000033827
AA Change: Y383C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033827
Gene: ENSMUSG00000031450
AA Change: Y383C

DomainStartEndE-ValueType
RGS 57 175 7.34e-35 SMART
S_TKc 190 455 3.42e-81 SMART
S_TK_X 456 535 3.21e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209909
AA Change: Y383C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211027
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates rhodopsin and initiates its deactivation. Defects in GRK1 are known to cause Oguchi disease 2 (also known as stationary night blindness Oguchi type-2). [provided by RefSeq, Jul 2008]
PHENOTYPE: Analysis of homozygous null mice revealed abnormal photoresponses and light-induced apoptosis in rods. Mutant mice may serve as models of Oguchi disease and retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,699,972 F328L probably benign Het
4930563M21Rik G A 9: 55,974,012 T482M probably benign Het
9030624J02Rik T C 7: 118,792,646 W494R probably damaging Het
Adam9 A G 8: 24,978,482 Y513H probably damaging Het
Adamts20 C T 15: 94,324,659 probably null Het
B3gnt5 A G 16: 19,770,009 D326G probably damaging Het
Cacna1g A G 11: 94,463,417 I224T probably damaging Het
Ccdc18 A G 5: 108,161,746 I402M probably benign Het
Cckar A T 5: 53,703,056 C73S probably damaging Het
Cdk13 C T 13: 17,739,154 R880H probably damaging Het
Col1a1 A G 11: 94,940,160 N218D unknown Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp2c69 A G 19: 39,842,921 F483L probably benign Het
Ddx60 A G 8: 61,983,905 D963G probably benign Het
Dhx8 G T 11: 101,737,687 A142S unknown Het
Dock7 C T 4: 98,992,448 R926Q probably damaging Het
Dscaml1 C T 9: 45,683,677 Q693* probably null Het
Dysf G A 6: 84,140,042 C1234Y probably damaging Het
Ercc1 G A 7: 19,355,177 probably null Het
Fam91a1 T C 15: 58,442,917 L549P probably damaging Het
Fxyd2 T A 9: 45,403,294 Y5N possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gpr182 T A 10: 127,750,506 D192V possibly damaging Het
Gps1 T C 11: 120,787,722 V286A possibly damaging Het
Hic1 G A 11: 75,166,317 P582L possibly damaging Het
Hist1h2bn T C 13: 21,754,486 Y122H probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Lactb T C 9: 66,970,645 K301E possibly damaging Het
Lrp3 A T 7: 35,204,168 V251E probably benign Het
Mapt G A 11: 104,298,998 G265S probably benign Het
Obscn A T 11: 59,035,130 D6245E probably damaging Het
Olfr118 G T 17: 37,672,557 C178F possibly damaging Het
Olfr1257 T C 2: 89,880,862 L12P probably damaging Het
Olfr1273-ps T A 2: 90,296,037 I275F probably damaging Het
Olfr340 A G 2: 36,452,605 S7G probably damaging Het
Olfr58 T A 9: 19,783,748 I205N probably damaging Het
Olfr777 T C 10: 129,269,021 T101A probably benign Het
Olfr832 T C 9: 18,945,119 L157P probably damaging Het
Oxsm A T 14: 16,241,904 H288Q probably benign Het
Pcdh9 C T 14: 93,015,842 M1128I possibly damaging Het
Pcdha8 T C 18: 36,994,561 Y699H probably damaging Het
Pgk2 A T 17: 40,207,568 I323N probably benign Het
Plin4 A G 17: 56,103,264 V1216A probably damaging Het
Ppargc1a T C 5: 51,462,834 probably benign Het
Ppil2 A G 16: 17,103,574 probably null Het
Prelp A T 1: 133,912,778 I322N probably benign Het
Prelp A T 1: 133,914,657 I250N probably damaging Het
Prss27 T A 17: 24,042,908 C63* probably null Het
Rab38 G A 7: 88,430,540 A47T possibly damaging Het
Rprd2 G A 3: 95,774,219 A436V probably benign Het
Sacs A T 14: 61,205,359 N1618I probably damaging Het
Scp2 T G 4: 108,105,140 S63R probably benign Het
Sftpb T G 6: 72,304,649 W9G probably damaging Het
Slco1a4 A T 6: 141,834,689 L125* probably null Het
Sptlc1 T C 13: 53,351,692 probably null Het
Sub1 T A 15: 11,986,474 M96L probably benign Het
Tanc1 T C 2: 59,837,114 V1233A probably benign Het
Tmem140 A T 6: 34,872,723 D58V probably damaging Het
Tmem231 G A 8: 111,926,892 probably benign Het
Tpt1 T C 14: 75,846,371 Y91H probably benign Het
Trap1 C T 16: 4,043,992 R636H possibly damaging Het
Ttc14 A G 3: 33,803,575 H275R possibly damaging Het
Zbtb44 T A 9: 31,064,214 I380N possibly damaging Het
Zcchc6 T A 13: 59,816,296 probably null Het
Zswim5 T C 4: 116,980,866 F798L possibly damaging Het
Other mutations in Grk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Grk1 APN 8 13413128 nonsense probably null
IGL00501:Grk1 APN 8 13407835 missense probably damaging 1.00
IGL00772:Grk1 APN 8 13405349 missense probably benign
IGL00905:Grk1 APN 8 13416068 missense probably benign 0.32
IGL01116:Grk1 APN 8 13405404 missense possibly damaging 0.52
IGL01976:Grk1 APN 8 13415993 missense probably damaging 1.00
R0463:Grk1 UTSW 8 13409279 missense probably damaging 1.00
R1600:Grk1 UTSW 8 13405406 missense probably benign 0.01
R1838:Grk1 UTSW 8 13416155 missense possibly damaging 0.77
R1911:Grk1 UTSW 8 13407923 missense probably damaging 0.99
R2122:Grk1 UTSW 8 13405221 missense probably benign 0.01
R4583:Grk1 UTSW 8 13409322 missense probably damaging 0.99
R5347:Grk1 UTSW 8 13414478 missense probably damaging 1.00
R5520:Grk1 UTSW 8 13409305 missense probably benign
R5682:Grk1 UTSW 8 13414351 missense possibly damaging 0.88
R6145:Grk1 UTSW 8 13405765 nonsense probably null
R6329:Grk1 UTSW 8 13405704 missense probably damaging 1.00
R6717:Grk1 UTSW 8 13416237 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTGGCCTCCAAGTCACTGG -3'
(R):5'- GGGACAGAATATCCTGCAGG -3'

Sequencing Primer
(F):5'- GGTAGGGTATCACTAGAGCCTC -3'
(R):5'- TGCAGGACCAGGAACCCAG -3'
Posted On2018-05-24